| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUUUCGUCCUUUUCCCCGGUUGCUGCUUGCUGUGAGUGUCUCUAGGG… | 1145 nt | 0.5013 | |
| CUUUUUCGUCCUUUUCCCCGGUUGCUGCUUGCUGUCCUGGUCCGCGCCA… | 1110 nt | 0.5009 |
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L38E family of ribosomal proteins. It is located in the cytoplasm. Alternative splice variants have been identified, both encoding the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome, including one located in the promoter region of the type 1 angiotensin II receptor gene. [provided by RefSeq, Jul 2008]
A study in humans using a custom-designed mRNA MPS primer panel for time since deposition (TsD) estimation in four body fluids (blood, semen, menstrual blood, and vaginal secretion) found that the RPL38 was included as a candidate mRNA marker [Hänggi et al. DOI:10.1016/j.fsigen.2025.103415]. A study in humans demonstrated that the RPL38 was identified as a highly expressed housekeeping gene exhibiting a low coefficient of variation across individuals differing in genetics, environment, age, and gender [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003].