Basic Information

Symbol
RPL4
RNA class
mRNA
Alias
Ribosomal Protein L4 60S Ribosomal Protein L4 UL4 L4 Large Ribosomal Subunit Protein UL4 60S Ribosomal Protein L1 RPL1
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_000968.4
Sequence length
2741.0 nt
GC content
0.4553

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-834.5 kcal/mol
Thermodynamic ensemble
Free energy: -885.13 kcal/mol
Frequency: 0.0000
Diversity: 763.38
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((((.......((((((...(((((((.(((((((((......).))))))))...))).))))...))).)))(((((((..((((((.(((((........)))))))))((((.((((((((((((((((((.((((.(((.((((..((((((((((((((((((((((...)))))))...((((((.........((.((((((.....)))))).))......)))))).....(((((((((((((..((((((((((((((((((.(((((((((((((...))))))))(((((((.....)))))))...((((((......((((((((((..(((.....)))...))))))...))))......))))))(((...)))(((((....((.........))...)))))..)))))..))))))))..)).))))))))..))..)))))))))))))))))...))))........(((((((((....)))))))))..((((((...(((...)))...)))))).........((((((((((((..(((..(((((...)))))))).((((((((..((((((((((.(((((.(((((.....)))))(((((....(((...(((......))).)))....)))))((((((..((((((((((((((......(((....(((((..(((.(.((..(((((((.((((.......((..((((((.....((((((((...........)))))))).....)))))).)))))).))))))).....)).))))..))))).)))......)))))))..)))))))..).((((.....))))((((((((...((((.......(((((.(.((((((((((((((......))))........))))))....(((.....(((((..((((.((((..((.....))..)))).(((..((((..(((.....................(((.(((...))).)))...((...........))...)))..))))..))).....((((((.((...)).)))))).....))))....)))))..))).(((((....)))))(((.......))).............(((.(((((((((((((.....))))))....(((..............((((((((((..........(.((((.......)))).).........)))))))))))))....)))).))))))...........))))).)))))....))))...)))).))))...))))).))))).)).)))...))))))))))))).......((((....)))))))))))))))).))))).)).))))).)))))))))).(((((((..(((((.(((.(((...)))..))).)))))....)))))))))))))))))))....))))...............((((((((((......))))))))))...((((((((((...))))))))))))..)))))))..(((((((.((............)).)))))))....(((((((........((((((((..((((.((.((((...(((.((..(((...((((((...((((((((((...(((.....(((((((((.((....)))))))))))...))).((((((((((..((.(((((..(((((((.(((......))).))))))).....))))).))..))))))))))....(((((.((....)).))))).(((((((((((...)))..))))..))))((((.(((((...)))))....))))...((((((....))))))......))))))..)))))))))))))..)).)))...)))))))))).(((....(((((....))))).....)))..............((((....))))..))))))))(((((((...((((((((((((..(((((((((....(((..(((((((((.(((((.((((((........)))))).....((((........))))..((((((((((((.((((........)))).........((((((.....((...(((.((((((..(((........((((...(((((((((((((.....................)))))))))))))....))))..........)))...))))))..)))....)).....)))))).......))))))))))))(((((((.((((..(((((...(((..(((.(((((((.....)))))))))).)))..))))).)))))).)))))..........)))))))..)))))))..)))............((((.(((.(((....))))))))))..................))))))....))).))))))).........((.((.((((((.......(((....)))........)))))).)).))((((((....(((...(((....))).)))..))))))..)))))....))))))).......(((((...)))))...))))))))))))))))((.((((.(((((..............)))))....)))).))...((((.((((.........)))))))).......
Thermodynamic Ensemble Prediction
.(((((((((......{((((((((((((((((.(((((((((,....}).))))))))...))).}))),{{||||{||{(|{{{...{|((||..,,|{||..,|||}||||||,|.((((((........)))))),},}}.,,}}..{{|||,,.,,,||||,||||,(((((((...)))))))..,(((((({{{......,{.((((((.....)))))).}|{,,...|||||,{{{{,(((((((((((,(,.((((((((((((((((((.(((((((((((((...))))))))(((((((,...,)))))))...((((((,{{,,,((((((((((..(((.....)))...))))))...,,,,,,,,,.}}})))|||.,,))){((((...,(,.........,,...)))))..)))))..))))))))..)).))))))))..,,,,))))))))))),||}||...||||..,,{{{,(((((((((....))))))))}.,{{{{{{|..((((..(((..(((((..(((......(((({{((......)))))))......)))..)))))..)))..)))).....{((,{.{|||(((((.....))))){{{{|...,|||...{{{.....,|||,||}....}}})}{{{((({{((((((((((((((......(((....(((((..((,,(.((..(((((((.((((.......{{..((((((.....((((((((...........)))))))).....)))))).}})))).))))))).....)).))))..))))).)))......)))))))..))))))),.,,,(((.....)))|{{{,..{{{{{{.,,,}},,.,{{{,,...{{{..|||||,..,......|))}}}.)},..,||||},..,}}...}}}}}}..,,|||||(({{..((.....))..||||.{{{..{{{{,.{{{........,..,,,.{...,.(((,((,...,||,|||,,,({...........}|...}}}..)))),,|||.....,{||||,({.,,|}.||||}|,.,..||}}}}||}||,|,{{|{.(((((({...))))))).......{(({{{{{{{..{{{,,||||||||||((((((.....))))))((({((....{{{{{....{{((((((,,,{,{,{,{{{{,({(((({{,.{{{,|||,|{{{,.....||||||||}||||.......,.||,,|{{,,,||,,||,((({(({((({........(((.((((.((((.{,{{{..{{{{..........,{{(((({...,,.....))}}}))}||,,,{((...((((((((((((((.((....((,{(((((((((((..{,..{((((({{((((((({((({..,(({{((((({,..{(((({,((((.(((((,,{..(((((((((((....,{{..((((((((((......))))))))))..}||((((((((...|}}}}||||}....{{,,},},...,}.,}}},}}.....)))))))))))..,.,,,.))))).))))})))))..{(((...{{(({((((({(,{.,,(.{{..{{||}.||||||,,.{{{{{{||||.,.(((.....((((((((,{((....)))))))))))...))}.,{((((((((..((.(((((..(((((((.(((......))).))))))).....))))).))..))))))))))}}}}|||||.,,....,,.,)))}.({{((((((((...))}.,))}},,}}))|{{{.(((({...}))))..,.}}}}...((((({....})))))......))))))},))))))||||||}..,}.)))),,|||||,,,))}}}.,,..(((((....))))){{....)}..............)))))))))),.,}.{((((....((((({....,))).)).},))))}{({{..,,.|||,.,{((,((.(.((((((..((((((...{,....})...)))))))))))).)))|)).,}|||||.....}}))||{{{{{{{.|,....}.))))))))}.)))))))))))))){((((.,......,.))))})).))))))))))))))..)}}.}}.}))}...}}}......(((((........))))).....((......))......................)))).)))).)))....,.}}}}.))))))},,{((,{{({..{(((({{{(,,..,,,}|||||||...,.||||}},}}),))),.}}}}||||}}}},.}))),.)))}}..,},}.}}},...}}))))}....,,,..}},,,..|||.,||.|}}}}}}})))}))))},.}}))).,)}},,,....,},}},.,..,.)))))))).,,)))}}..,,,,..,}}}}}.}))),})}})},}}))})))}..,,((({{{......,,},))}))),,,)))))))))),)))}...,,,))}})))))),}||}}}||,......,|||{{..,))))),},))))}..)))))))))((.((((.(((((..............)))))....)))).))...((({{((((.........)))))))).......

Transcripts

ID Sequence Length GC content
AAGCACUUCCUUUUCCUGUGGCAGCAGCCGGGCUGAGAGGAGCGUGGCU… 2741 nt 0.4553
Summary

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L4E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human prostate tissue demonstrated that the lncRNA ENST00000561775 is upregulated in samples with a high postmortem interval (PMI) compared to those with a low PMI, as identified through total RNA sequencing and differential expression analysis [Javan et al. DOI:10.1038/s41598-025-29561-7]. This biomarker is associated with the gene RPL4 and its expression pattern contributes to the molecular profile used for PMI estimation. A study in mice demonstrated that the RPL4 mRNA levels in retinal cells decreased in a linear correlation with the post-mortem interval, indicating its utility for PMI estimation [Scrivano et al. DOI:10.1007/s00414-019-02125-x].