Basic Information

Symbol
RPL5
RNA class
mRNA
Alias
Ribosomal Protein L5 PPP1R135 UL18 L5 Protein Phosphatase 1, Regulatory Subunit 135 Large Ribosomal Subunit Protein UL18 60S Ribosomal Protein L5 MSTP030
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_000969.5
Sequence length
1028.0 nt
GC content
0.4504

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-297.80 kcal/mol
Thermodynamic ensemble
Free energy: -318.42 kcal/mol
Frequency: 0.0000
Diversity: 248.92
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...................(((((.(((((.(((((((.((((.((((((.((((....)))))))))).)))))))...((((.(((((((.(((........)))..))))))).))))((((((((..................(((.((((.........)))).))).....))))))))........................((((((........((....(((((((((((.((.((.((....))..((((((((((((.(((.(((........))).))).).))))))).)))).)).))))))))))))))).......))))))......((((.(((((..(((((....))))))))).).))))..)))).))))))).)))...(((.((((((((.((((((.....))))))((((((..((((((((..((((((((.(...((((((.....)))))).).)))).))))..)))))))).(((.........)))))))))(((((........))))).....((((((((((((((......(((((.(((..((((((((((((.((........((((...((((((...........((((((..((((((.......(((...............)))..((.(((((.....(((.(((..((.(((...((.((....)).))...)))))..)))..)))(((....((((((((.....................(((((.......))))).....(((((.(..(((....))).))))))))))))))....)))..........))))).)).............((.....(((.......))).....))))))))))))))...))))))))))........))))))))))))))))).)))))......)))).))))))))))..............((((((.(((....)))))))))...)))))))))))..........
Thermodynamic Ensemble Prediction
.........{{{{(,{,({(((,,,,}|||,||,|{{(.((((.((((((.((((....)))))))))).)))))}})))}|.,.,,,,(((((((....,,,(({{{.|{{||...,,.{((((((((....,..........{{{(,{,((({......}},)),}.)))}....))))))))}.......................((((((...,,...((....(((((((((((.((.((.((....})..{(((((((((((.(((.(((........))).))).).))))))).)))}.)).)))))))))))))))......,)))))),,}||.||||,{((((..(((((....))))))))).}.||||{|||{{{{{||,||,(((({.((,{((((((({.......}.}})))))))})))))..((((((((..((((((((.{.,.((((((.....)))))).).)))},))))..)))))))){{{{.........)))))}}{((((((........))))))}...{(((((((((((((,,..,,(((((.(((,,((({{{{{{|||,||,.,....|||||..,{{{{,.((({{{{.,..((((({.,((((((.......{({....,,....,,..,|||,.((.(((((,....,((.(((..{{.{{|,,,{{.{{...,)).}}...))))}..))),.,},{{{....((((((((....,............||..(((((.......))))).....((((,,{..(((....))).})))))))))))))....)))..........}}}}}.},................,.,{{{{.....,}},......},))))))))))))..,,))))))),|,||,....}|))))}}))))))}}},)))))....,,)))),|)))))}}}}....,}})}.{({.((((({,((,....})))))))).}))...}}}}}....)))}}}}.

Transcripts

ID Sequence Length GC content
CCUUUUCCCACCCCCUAGCGCCGCUGGGCCUGCAGGUCUCUGUCGAGCA… 1028 nt 0.4504
Summary

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L18P family of ribosomal proteins and component of the 60S subunit. The encoded protein binds 5S rRNA to form a stable complex called the 5S ribonucleoprotein particle (RNP), which is necessary for the transport of nonribosome-associated cytoplasmic 5S rRNA to the nucleolus for assembly into ribosomes. The encoded protein may also function to inhibit tumorigenesis through the activation of downstream tumor suppressors and the downregulation of oncoprotein expression. Mutations in this gene have been identified in patients with Diamond-Blackfan Anemia (DBA). This gene is co-transcribed with the small nucleolar RNA gene U21, which is located in its fifth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. [provided by RefSeq, Mar 2017]

Forensic Context

No relevant information is available at the moment.