Basic Information

Symbol
RPL7
RNA class
mRNA
Alias
Ribosomal Protein L7 HumL7-1 UL30 L7 Large Ribosomal Subunit Protein UL30 60S Ribosomal Protein L7
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Other applications

MANE select

Transcript ID
NM_000971.4
Sequence length
1233.0 nt
GC content
0.4031

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-324.90 kcal/mol
Thermodynamic ensemble
Free energy: -353.42 kcal/mol
Frequency: 0.0000
Diversity: 291.13
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((..((((....))))....)))))(((((((((.(((((...(((.((((.(((......))).)))))))......((((((((............(((........)))(((((((((((((((((((((((.((((((((.(((.(((..(.((((((.((((.((((((...(((..((.((((..........))))))...)))..............((((.((((((((..........(((((.(((((((((((((((((((((..(((...)))..)))))............))))))..))))))((((((....))))))......)))))))))))))))))))))(((((((((((((.(((.((((((........)))))).))).)))..(((((.((.(((......(((.(((.((((..((((((....(((((...(((((.....)).))).......((((((.((((.(((((..((..........)).))))).)))).....)))))).)))))....))))))..))))))).)))))).)).)))))))))))))))))))))...((((......))))....(((((...)))))..)))))))))).).))).)))......((((((((((...)))))..)))))...(((((((((((((((((..((((((....((((.....(((((((((.(((......((((...(((((((((((.(...(((....)))..).)))))))))))))))(((.(((((((((.((..((..((...((((((.(((((((....)))))))..))))))..)).))))))))))))).)))))))))))))))....((((......))))((((..((......))...))))......))))))))))..))))))))..)))).).))))......))).))))).)))))).......))))))).....(((((((((....)))))))))........(((((.(((((....(((((((((((.........))))))))))).....)))))))))).(((((.((.(((((.(((.......))).))))).))..)))))((((((........)))))).))))))))))))))))))(((((((........)))))))......))))))))))))))....
Thermodynamic Ensemble Prediction
(((((..((((....))))....)))))(((((((((.((({,...(((.((((.(((,...,.})).})))))}..,,..{{((((((|..,,|||,...||{,,.,..|.|}}((((((((((,((((((((((((.((((((((((((.(((..(.((((((,(({({{.,{,...,{{,..{{.{({{,....,,,.,||||||.,.{,{.,,,,..,,....,{(((.((((((((..........((((,{(((({((((((((((({{{(({((({...})).}))))}............)))))}..}))))}{(((((....)))))}......))))))))))))))))))))}||{((((((((((.(((.((((((,,...,..}))))).))).))}..{{{{{||||||||{{{..{{{{|,,,||{|.(((((...)))))..,,,.,,{||}....}}..}}.,||,,,,,||||}|{||,{{{,...{{.....{{{{{|..,})))}),.},}}}.,,)))}}}}}|||,|||||.,,}))),,.},|}}}|}},}},)}}}}}})})))))}})))}}})}||{,....,,|},,.,,,(((((...)))))...,,,)))))).}.))).)))......((((((((((...)))))..)))))...(((((((((((((((((..((((((....((((.....(((((((({,(((......((((,..{((((((((((.,.,.(((....))).,).)))))))))))))))(((.((((((({{{(({.{,..((...((((((,(((((((....))))))).,))))))..)).))))))))))))).)))))))))))))))...,{(({......)}})|(((..,{......}}...))))......))))))))))..))))))))..)))).).))))....},))).))))).)))))).......|||}}}},....(((((((((....)))))))))........(((((.(((((....(((((((((((.,,....,,))))))))))).....)))))))))).{{(((.((.(((((.(((.......))).))))).))..))}}|{,,{{{||...}},)))))).}))))))))))))))))),|}}..,,{{.{{(((....))).)).}))))))))))))))....

Transcripts

ID Sequence Length GC content
CCUCUUUUUCCGGCUGGAACCAUGGAGGGUGUAGAAGAGAAGAAGAAGG… 1233 nt 0.4031
AGCCGUCCGCGGAGCCGAGCCGGGUAGCCCCUCUCACACGGCCGUGGCC… 1799 nt 0.4892
Summary

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L30P family of ribosomal proteins. It contains an N-terminal basic region-leucine zipper (BZIP)-like domain and the RNP consensus submotif RNP2. In vitro the BZIP-like domain mediates homodimerization and stable binding to DNA and RNA, with a preference for 28S rRNA and mRNA. The protein can inhibit cell-free translation of mRNAs, suggesting that it plays a regulatory role in the translation apparatus. It is located in the cytoplasm. The protein has been shown to be an autoantigen in patients with systemic autoimmune diseases, such as systemic lupus erythematosus. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the RPL7 was identified as a downregulated hub gene in HDAC11-overexpressing cardiac mesenchymal stem cells, indicating its role in transcriptional reprogramming [Zhang et al. DOI:10.3390/biom15050662]. In the Australian sheep blowfly *Lucilia cuprina*, the RPL7 was identified as a highly expressed transcript in embryonic and larval expressed sequence tag datasets, contributing to the foundational genomic resources for this forensically relevant species [Lee et al. DOI:10.1186/1471-2164-12-406].