Basic Information

Symbol
RPL7A
RNA class
mRNA
Alias
Ribosomal Protein L7a SURF3 60S Ribosomal Protein L7a Surfeit Locus Protein 3 PLA-X Polypeptide TRUP L7A EL8 Thyroid Hormone Receptor Uncoupling Protein Large Ribosomal Subunit Protein EL8 Surfeit 3 SURF-3
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_000972.3
Sequence length
887.0 nt
GC content
0.5186

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-282.80 kcal/mol
Thermodynamic ensemble
Free energy: -299.31 kcal/mol
Frequency: 0.0000
Diversity: 223.69
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((.(((((((((...(((.......((....))......)))...)))).....((.(((....))))).(((.((.....))))).)))))...)))))).((.((((.(((.(((((.......(((..........)))...((((((((((((((.((((.........(((.((((((...((.(((((((((((.((......)).)))))....).)))))..))...)))))).)))..(((((((((((......(((((((..(..(((((.((...(((((.(((...(((.(((((((...((((..............)))).....)))).........))).))).)))))))))))))))..)..)).....))))).....(((....)))..(((((.(((.....)))))))).)))))))........(((((((((..(((.(((..........))).)))))))))))).))))..((((((((((.((((((.((((((((..((((((((.((((((((.((((...(((...))))))).)))).....))))..))))))))(((((((.....)))).)))........((.((..((((.(((((((....)))))...))..))))..)).)).((((.....(((((((...)))))))..))))..)))))..))).).))))).)))))).))))..)))).)))..)))))))..)))).......(((((..((.(((((..(((......)))...)))....))))..)))))))))).)))....(((((((((....))).....))))))......................)))).))....
Thermodynamic Ensemble Prediction
{(((((...((((..((.,({....,..)|})..)))).))))))..,((((((({,.(((((((((.(((...((((((.(((.,.(((.((.((((((.((((((((((....{(({{{{......,,({(.......,|,||}.||{|||,||...,}},,.}}},,.,.,...)))}}}))))).)....)))))))))).,.))).)..)))))))).).)))))))).|||{,.{((((((,(((((((((..{{,..,,..((((((((((..(((((.((...((({{{(((...(((.(((((((...((((............}.)))).....)))),........})).))).))))))))))))))).....((((((.{{{((....((((((((((({.(((((.(((.....)))))))).{{.||.},,....,{.{(((({...}))))).}....(((.(((.((((((((((.((((.(((.....)))})))))))),}))))))).))){(((((((.((((((((.((((...(((...))))))).)))).....))))..)))))))}.}))))))))}..|}}.{{|{....))))..)),.,)),)))))).....)))))))).))..}.)}.)))))))))))))..}}),|}|}}.|||.{{(((((,.....{,.,..{{{..,||.||...,|||{|}}..}}}.}}))},,,,)))})}}|,(({.,{{..(((((..({.{{(((..(({......)))...)))....)}))..)))))...,}))))....((((((({{....}},....)))))))........,{{........,,..,))))))}..

Transcripts

ID Sequence Length GC content
CUUUCUCUCUCCUCCCGCCGCCCAAGAUGCCGAAAGGAAAGAAGGCCAA… 887 nt 0.5186
Summary

Cytoplasmic ribosomes, organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L7AE family of ribosomal proteins. It can interact with a subclass of nuclear hormone receptors, including thyroid hormone receptor, and inhibit their ability to transactivate by preventing their binding to their DNA response elements. This gene is included in the surfeit gene cluster, a group of very tightly linked genes that do not share sequence similarity. It is co-transcribed with the U24, U36a, U36b, and U36c small nucleolar RNA genes, which are located in its second, fifth, fourth, and sixth introns, respectively. This gene rearranges with the trk proto-oncogene to form the chimeric oncogene trk-2h, which encodes an oncoprotein consisting of the N terminus of ribosomal protein L7a fused to the receptor tyrosine kinase domain of trk. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in the Australian sheep blowfly *Lucilia cuprina* identified the RPL7A as one of the most abundantly expressed genes in embryonic and larval expressed sequence tag datasets [Lee et al. DOI:10.1186/1471-2164-12-406].