Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCUUCUCUCGCCAGGCGUCCUCGUGGAAGUGACAUCGUCUUUAAACCCU… | 1105 nt | 0.5303 | |
| CCUUCUCUCGCCAGGCGUCCUCGUGGAAGGCCCGGGACCGCGGGAUGGG… | 1165 nt | 0.5399 |
Summary
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which is the functional equivalent of the E. coli L10 ribosomal protein, belongs to the L10P family of ribosomal proteins. It is a neutral phosphoprotein with a C-terminal end that is nearly identical to the C-terminal ends of the acidic ribosomal phosphoprotein s P1 and P2. The P0 protein can interact with P1 and P2 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. Transcript variants derived from alternative splicing exist; they encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Forensic Context
A study in humans demonstrated that the RPLP0 was evaluated as a candidate housekeeping gene for mRNA quantification from forensic body fluid stains, where it showed similar expression to PPIA, PGK1, and ACTB in semen samples but generally lower expression in other examined fluids like saliva, blood, vaginal secretions, and menstrual blood [Moreno et al. DOI:10.1111/j.1556-4029.2012.02086.x]. In Sarcophaga peregrina, the RPLP0 was evaluated as one of ten candidate reference genes for RT-qPCR normalization during intrapuparial development, where it was ranked as highly stable at 35°C and 25°C [Shang et al. DOI:10.1093/jme/tjz137]. A study in rats demonstrated that the RPLP0 was identified as a differentially expressed RNA marker for hypothermia diagnosis, showing significantly higher abundance in control hypothalami (44 tags) compared to hypothermic hypothalami (23 tags) [Takamiya et al. DOI:10.1016/J.Jflm.2012.04.017]. In the blow fly *Calliphora vicina*, expression analysis of the RPLP0 showed constant levels with no significant differences over time or between diapausing and non-diapausing larvae, though a cyclic expression pattern could not be excluded [Fremdt et al. DOI:10.1007/s00414-013-0920-x].