| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCCCUUUCCUCAGCUGCCGCCAAGGUGCUCGGUCCUUCCGAGGAAGCUA… | 1174 nt | 0.4744 | |
| CCCCUUUCCUCAGCUGCCGCCAAGGUGCUCGGUCCUUCCGAGGAAGCUA… | 1099 nt | 0.4759 |
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal phosphoprotein that is a component of the 60S subunit. The protein, which is a functional equivalent of the E. coli L7/L12 ribosomal protein, belongs to the L12P family of ribosomal proteins. It plays an important role in the elongation step of protein synthesis. Unlike most ribosomal proteins, which are basic, the encoded protein is acidic. Its C-terminal end is nearly identical to the C-terminal ends of the ribosomal phosphoproteins P0 and P2. The P1 protein can interact with P0 and P2 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. Two alternatively spliced transcript variants that encode different proteins have been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the RPLP1 was identified as a highly expressed housekeeping gene exhibiting a low coefficient of variation across individuals differing in genetics, environment, age, and gender [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003]. A study in mice demonstrated that post-mortem interval (PMI) induces widespread transcriptomic alterations in brain tissue, with a rapid and widespread upregulation of ribosomal protein (RP) genes across various cell types that plateaus at approximately 36 hours [Guo et al. DOI:10.1016/j.ijbiomac.2025.147708].