Basic Information

Symbol
RPLP1
RNA class
mRNA
Alias
Ribosomal Protein Lateral Stalk Subunit P1 LP1 P1 Large Ribosomal Subunit Protein P1 60S Acidic Ribosomal Protein P1 Ribosomal Protein, Large, P1 Acidic Ribosomal Phosphoprotein P1 RPP1 RRP1
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_001003.3
Sequence length
1174.0 nt
GC content
0.4744

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-380.90 kcal/mol
Thermodynamic ensemble
Free energy: -397.75 kcal/mol
Frequency: 0.0000
Diversity: 251.81
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
............(((((((....((((((.((((((((....)))).....((((.(.(((((((((...))))))))).))))))))))))))).....)))))))((..((.((((((.((((((((....((((((.......)))...)))....(((((.(((((((.((..((((....((((((((((...)))).((((.............))))......((..(((((((..((((((.(((.....(((((.((......))..)))))..)))))))))..)))))))..))))))))))))..)).)))))))))))).((.((((..(((((((.((.(((.(((..(((((........))))).))).))).)).))))))).)))).))....(((((((((((((((.(((.((....)).)))..(((.((((((((.(((((((.....))))))))))............(((((.........)))))..(((.((((..((((((((..((((((((((.((((((..(((((((........)))))))..((((((.((((((..((((.(((........))).))))(((((((((((((...(((...(((.((..((((......))))..)).)))....)))(((....))).((((((........)))))).))))))))).))))(((.((((((....)))))))))(((((((((.(((((.(.....).))))))))))...((((......))))(((.((((((((((...(((((((....))))....)))))).))))))).)))......))))....(((........)))..)))))).)))))).)).)))).))))))))))......))))))))))))...)))))))))))((((....)))).((((((.(((.(((((.....((((............(((((((...)))))))...((((.((.....)).))))...........))))......)))))))))))))).....)))))))))))).)))((((((((..(((.(..(((((.........)))))..).)))..)))).))))....)))))))...).))))..)).)).))...
Thermodynamic Ensemble Prediction
............(((((((....((((((.((((((((....)))).....((((.(.(((((((((...))))))))).))))))))))))))).....)))))))((..((.{(((((.,(((((((....((({{{.....,,|||,..}}}.|,.(((((.(((((((.((..((((....((((((((((...)))).((((..........,..))))......((..(((((((..((((((.(((.....(((((.((......))..)))))..)))))))))..)))))))..))))))))))))..)}.)))))))))))).({.((((..(((((((.((.(((.(((..(((((........))))).))).))).)).))))))).)))).})....(((((((((((((((.,,,.{({{,{,,{{|,..,||,{{|{||{(.(((((((.....))))))),}}|,..........(((({.........})))).,{,{.((({..((((((((.,((({{(((((.((((((..((((({{.......,}}})}}}..((((((.((((((,,{{((.(((.......,))).))),(((((((((((((...(((...(((.((..((((......))))..)).)))....))){((....))}.((((((........)))))).))))))))).))))(((.((((((....))))))))),{{,(((((.(((((.(.....).))))}))))}...((((......)))){{{.((((((({{{,,.||{((({....})))...|}}||}},}}))))).}}}..,,,,|||,.,,.{{{........|||,.}}}}}}.}}}}}}.}},})}}.}}}}))}))),.....}))))))))))),,,))}},}}|||,((({....))))}||{{{|.{||,{{{((...,|{|||}},,,..,|,,.(((((((...)))))))...((((.((.....)).))))...........}}}),..,}}))))))))}})))}.....)))))))))))).))).,,.{{{{..(((.(..(((({.........))))).,).))),.}}}}.,,,,....)))))))...),))),..}).)).))...

Transcripts

ID Sequence Length GC content
CCCCUUUCCUCAGCUGCCGCCAAGGUGCUCGGUCCUUCCGAGGAAGCUA… 1174 nt 0.4744
CCCCUUUCCUCAGCUGCCGCCAAGGUGCUCGGUCCUUCCGAGGAAGCUA… 1099 nt 0.4759
Summary

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal phosphoprotein that is a component of the 60S subunit. The protein, which is a functional equivalent of the E. coli L7/L12 ribosomal protein, belongs to the L12P family of ribosomal proteins. It plays an important role in the elongation step of protein synthesis. Unlike most ribosomal proteins, which are basic, the encoded protein is acidic. Its C-terminal end is nearly identical to the C-terminal ends of the ribosomal phosphoproteins P0 and P2. The P1 protein can interact with P0 and P2 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. Two alternatively spliced transcript variants that encode different proteins have been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the RPLP1 was identified as a highly expressed housekeeping gene exhibiting a low coefficient of variation across individuals differing in genetics, environment, age, and gender [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003]. A study in mice demonstrated that post-mortem interval (PMI) induces widespread transcriptomic alterations in brain tissue, with a rapid and widespread upregulation of ribosomal protein (RP) genes across various cell types that plateaus at approximately 36 hours [Guo et al. DOI:10.1016/j.ijbiomac.2025.147708].