Basic Information

Symbol
RPLP2
RNA class
mRNA
Alias
Ribosomal Protein Lateral Stalk Subunit P2 RPP2 60S Acidic Ribosomal Protein P2 D11S2243E LP2 P2 Acidic Ribosomal Phosphoprotein P2 Large Ribosomal Subunit Protein P2 Renal Carcinoma Antigen NY-REN-44 Ribosomal Protein, Large, P2 MGC71408
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_001004.4
Sequence length
462.0 nt
GC content
0.5736

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-168.70 kcal/mol
Thermodynamic ensemble
Free energy: -177.47 kcal/mol
Frequency: 0.0000
Diversity: 85.77
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((((..((((((..(.((((.((...(((.(((....)))))))))))).)..)).))))(((((.((((((.((((((....((((...((((((.(((((....))))).........))))))...))))...(((((...)))))....)))))))))))).)))))..((((..(((((((.............)))))))((((.......)))).....))))...(((((((.((((((((....))))))))..))))..)))((((((((((..((((..........)))).))))))))))((((((.(((.........))))))))))))))))))..(((((.((((((((....((((((....))))))........(((((((((.(.....).)))))))))(((......))).......))))))).).))))).
Thermodynamic Ensemble Prediction
.(((((((((.,{(({((..,.((((.((...(((.(((....)))))))))))).)..)),)}}{(((((.((((((.((((((.{,,{{({...{{{(((,.{{....(((({........}}}))})))|||))),..,(((({...)))))).,.)))))))))))).))))).,((((..(((((((.,..........,)))))))((((.......)))).....))))...(((((((.((((((((....))))))))..))))..)))((((((((((,,{,,,,.,.......}))).}}))))))))((((((.(((.........))})))))))))))))))..(((((.((((((((.{,.((((((....}))))}..,.....(((((((((.{.....).))))))))){((......))}.......))))))).}.))))).

Transcripts

ID Sequence Length GC content
CCUUUUCCUCCCUGUCGCCACCGAGGUCGCACGCGUGAGACUUCUCCGC… 462 nt 0.5736
Summary

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal phosphoprotein that is a component of the 60S subunit. The protein, which is a functional equivalent of the E. coli L7/L12 ribosomal protein, belongs to the L12P family of ribosomal proteins. It plays an important role in the elongation step of protein synthesis. Unlike most ribosomal proteins, which are basic, the encoded protein is acidic. Its C-terminal end is nearly identical to the C-terminal ends of the ribosomal phosphoproteins P0 and P1. The P2 protein can interact with P0 and P1 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified ENST00000530797.5 as a down-regulated mRNA in peripheral blood mononuclear cells of ST-elevation myocardial infarction patients compared to non-ST-elevation myocardial infarction patients, with a fold change of 17.72, and classified it as a diagnostic biomarker for acute myocardial infarction [Zhong et al. DOI:10.1097/MD.0000000000013066].