| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAGAGCCUAGCUGCUGCGCGCGUCGGAGAGGCUCCUGGGAAACUCCC… | 1425 nt | 0.5923 |
Predicted to be involved in regulation of mitotic cell cycle. Predicted to act upstream of or within regulation of cell cycle. Predicted to be located in membrane. Predicted to be active in cytoplasm. [provided by Alliance of Genome Resources, Apr 2025]
A study in mice demonstrated that acute alcohol exposure during neurulation induces rapid transcriptomic changes in the rostroventral neural tube, with RPRM, a p53 pathway gene, being significantly up-regulated (+0.41 Log2FC) 2 hours post-exposure [Boschen et al. DOI:10.1016/J.Alcohol.2022.09.001].