| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCUUUCCCUGCCGCCGCCGAGUCGCGCGGAGGCGGAGGCUUGGGUGCG… | 503 nt | 0.4911 |
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S12E family of ribosomal proteins. It is located in the cytoplasm. Increased expression of this gene in colorectal cancers compared to matched normal colonic mucosa has been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the RPS12 was among the most highly expressed housekeeping genes with a low coefficient of variation across individuals, indicating its insensitivity to genetic, environmental, age, and gender differences [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003]. In mice, ribosomal protein genes, including the RPS12, exhibited the most prominent differential expression in cell subpopulations experiencing greater perturbations during post-mortem interval, with their dysregulation linked to cell death [Guo et al. DOI:10.1016/j.ijbiomac.2025.147708].