Basic Information

Symbol
RPS13
RNA class
mRNA
Alias
Ribosomal Protein S13 40S Ribosomal Protein S13 US15 S13 Small Ribosomal Subunit Protein US15
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_001017.3
Sequence length
527.0 nt
GC content
0.4516

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-143.60 kcal/mol
Thermodynamic ensemble
Free energy: -153.17 kcal/mol
Frequency: 0.0000
Diversity: 129.68
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((((((((((...(((.((.((((..(((....))).)))).))..))).((((...((((((((((.((....((((...)))).......)).))))))))))....))))..(((((((((..............((((......))))...))))))))).)))))).)))))...))))).....(((..((((((...(((((((((((((((.((((.......((((((....)))))).....((((((((((...((((((....))))))................((((((....))).)))...((((((((...................)))))))).......((((.....(((((..(((((((((.....)))))))))..)))))..))))..)))))))))).((........)).......................))))...)))))).))))........)))))...))))))..)))................
Thermodynamic Ensemble Prediction
.((((((((((((((((.,.(((,{{.{(((.,((,,,,.}}}.}}}|,|},,|||,,({{...{{{||||||{|||....{{{|,,,))}),,....,)),,)}}||||}}....)})),,(((((((((..,...........((((......))))...))))))))).)))))).))))}..,))))).....{,{.,{({((({{,{({({(({{(((((({((((.......,{((((....))))},.....((((((((((.{{({((((..,.||||||,...............{{,{((....})).}}}...}},}}}}}.}}}}}}.}}}...{{,..,{||,.,,....))){|||..,,,(((((..(((((((((.....)))))))))..)))))..}))}..)))))))))).....,.....))}.....|,,,..,,.........)))),},)))))).})},.,,.,}})))))}.,,|||||,..,,,,,}}},,.........

Transcripts

ID Sequence Length GC content
CCUUUCGUUGCCUGAUCGCCGCCAUCAUGGGUCGCAUGCAUGCUCCCGG… 527 nt 0.4516
Summary

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S15P family of ribosomal proteins. It is located in the cytoplasm. The protein has been shown to bind to the 5.8S rRNA in rat. The gene product of the E. coli ortholog (ribosomal protein S15) functions at early steps in ribosome assembly. This gene is co-transcribed with two U14 small nucleolar RNA genes, which are located in its third and fifth introns. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Forensic Context

No relevant information is available at the moment.