| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCUUUCGUUGCCUGAUCGCCGCCAUCAUGGGUCGCAUGCAUGCUCCCGG… | 527 nt | 0.4516 |
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S15P family of ribosomal proteins. It is located in the cytoplasm. The protein has been shown to bind to the 5.8S rRNA in rat. The gene product of the E. coli ortholog (ribosomal protein S15) functions at early steps in ribosome assembly. This gene is co-transcribed with two U14 small nucleolar RNA genes, which are located in its third and fifth introns. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
No relevant information is available at the moment.