| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUUCCUCUUUUACCAAGGACCCGCCAACAUGGGCCGCGUUCGCACCAA… | 488 nt | 0.4898 |
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S17E family of ribosomal proteins and is located in the cytoplasm. Mutations in this gene cause Diamond-Blackfan anemia 4. Alternative splicing of this gene results in multiple transcript variants. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Apr 2014]
A study in mice demonstrated that ribosomal protein (RP) genes, including the RPS17, exhibited a rapid and widespread upregulation across various cell types with increasing post-mortem interval (PMI), plateauing at approximately 36 hours [Guo et al. DOI:10.1016/j.ijbiomac.2025.147708].