Basic Information

Symbol
RPS17
RNA class
mRNA
Alias
Ribosomal Protein S17 RPS17L1 RPS17L2 RPS17L ES17 S17 Small Ribosomal Subunit Protein ES17 40S Ribosomal Protein S17 MGC72007 Ribosomal Protein S17-Like DBA4
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_001021.6
Sequence length
488.0 nt
GC content
0.4898

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-150.70 kcal/mol
Thermodynamic ensemble
Free energy: -159.05 kcal/mol
Frequency: 0.0000
Diversity: 125.23
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((((((.....(((((........(((((((.(((.(((.......)))..))).))))))))))))....)))))......(((((((((.((..(..............)..)).))))))))).)))))))).((..((.((((.(((.....))).........((((........))))..(((.(((..((((.(((((((((.((((((.....((((((((.(((....((((.(((..(((((..(((...(((.((((..........((((....))))((((((.((((((..((((....)))).))))))..))))))...((((((((((...)).)))))))))))).)))...)))....)).)))..))).))))))))))............))))).))).))).)))))))))))))..)))))).....................)))).))..))...
Thermodynamic Ensemble Prediction
(((((((({(({,.....(((((........(((((((.(((.(((.......)))..))).))))))))))))....,,}}}..,,..(((((((((.((..(..............}..)).))))))))).))))}}}}.|{..,,.{{{{,(({.....||}..||.....{{{,||.,,,..}}}}.,(({,({{..|{{|,{((((((((.((((((.....(((((,{{,{({{{.{((((.(((..((({{,,(((...(((.((((.......,,,((((..,.})}}((((((.((((((..((((....)))}.))))))..))))))...{((((((({{...}}.)))))))})))).)))...})),.,.)).)))..))).)))))}})))}...........))))).))).))).)))))))))}))),.))))))}|,.,,,,,...,,,,....,)))).,},.}}...

Transcripts

ID Sequence Length GC content
GUUUCCUCUUUUACCAAGGACCCGCCAACAUGGGCCGCGUUCGCACCAA… 488 nt 0.4898
Summary

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S17E family of ribosomal proteins and is located in the cytoplasm. Mutations in this gene cause Diamond-Blackfan anemia 4. Alternative splicing of this gene results in multiple transcript variants. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Apr 2014]

Forensic Context

A study in mice demonstrated that ribosomal protein (RP) genes, including the RPS17, exhibited a rapid and widespread upregulation across various cell types with increasing post-mortem interval (PMI), plateauing at approximately 36 hours [Guo et al. DOI:10.1016/j.ijbiomac.2025.147708].