Basic Information

Symbol
RPS18
RNA class
mRNA
Alias
Ribosomal Protein S18 D6S218E KE-3 HKE3 US13 KE3 S18 Small Ribosomal Subunit Protein US13 40S Ribosomal Protein S18 Rhabdomyosarcoma Antigen MU-RMS-40.21 Ke-3 Ke3
Location (GRCh38)
6:33272075-33276511
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Postmortem interval inference
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_022551.3
Sequence length
549.0 nt
GC content
0.5228

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-182.1 kcal/mol
Thermodynamic ensemble
Free energy: -192.39 kcal/mol
Frequency: 0.0000
Diversity: 100.42
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......(((.(((((((((((.........(((((((((..(((((.((((.(((((((((((...........((...(((((.....((((((((((.....(((((..(((........)))....)))))...(((......)))((((((.........)))))).))))))))))....)))))...)).((((.....)))).)))).))..))))))))))))..(((((..(((((((....)))))))....)))))))))))))))).....(((((..((((((......((((((((((((..((.((.......)).))..((((..(((...)))..)))).....((((((........))))))..(((((.....)))))((((.....)))))))))).)))))).(((((.((....))))))).(((((((........(((((.....))))).......))))))).))))))......)))))))))))))...(((((....)))))........))).))).
Thermodynamic Ensemble Prediction
.......,,({(((((((((((,.{{.{{.{({{{{||{||.||({(.((((,((((((((({(...........{,...(((((.....((((((((({,({..,{((((((((........))),{,{||.,(((.{((......))))}|)}|.,,......)))))))))))))))))....)))))...,}.((((.....)))).})))}},..))))))})))))..(((((.,(((((((....})))))).,..)))))}||}||}||||...,.,{{{|}}{(((({......((((((((((((..((.((.......)).))..((((..(((...)))..)))).....((((((.,......))))))..(((((.....)))))((((.....)))))))))).)))))).(((({{((....))))))).(((((((.....,,,(((((,...,)))))....,},))))))).)}}}}}......,}))))))))))),..||||.....,||||........,}}.}},.

Transcripts

ID Sequence Length GC content
NM_022551.3 NCBI
CUCUCUUCCACAGGAGGCCUACACGCCGCCGCUUGUGCUGCAGCCAUGU… 549 nt 0.5228
Summary

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S13P family of ribosomal proteins. It is located in the cytoplasm. The gene product of the E. coli ortholog (ribosomal protein S13) is involved in the binding of fMet-tRNA, and thus, in the initiation of translation. This gene is an ortholog of mouse Ke3. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice and rats demonstrated that Rps18, an 18S ribosomal RNA, is a suitable biomarker for postmortem interval (PMI) estimation in heart and liver tissues, showing a linear correlation with degradation up to one week postmortem in water-immersed rat brain tissue [Song et al. DOI:10.1007/s00414-023-03091-1]. Research in human and rodent models further established its utility as a stable reference gene in the analysis of multi-RNA markers for PMI estimation [Mróz et al. DOI:10.1016/j.jflm.2025.102946]. A study in mice demonstrated that Ribosomal protein S18 (RPS18) mRNA was used as an endogenous reference gene for normalizing the expression of immediate early genes in heart tissue following chlorpromazine administration [Sakai et al. DOI:10.1016/J.Legalmed.2010.07.005]. A review of molecular methods for post-mortem interval estimation identified RPS18 mRNA as a candidate target biomarker used in mathematical models for PMI estimation in mouse tissues [Scrivano et al. DOI:10.1007/s00414-019-02125-x].