Basic Information

Symbol
RPS21
RNA class
mRNA
Alias
Ribosomal Protein S21 ES21 S21 Small Ribosomal Subunit Protein ES21 8.2 KDa Differentiation Factor 40S Ribosomal Protein S21 Human Leukemia Differentiation Factor HLDF
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_001024.4
Sequence length
358.0 nt
GC content
0.5223

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-121.60 kcal/mol
Thermodynamic ensemble
Free energy: -128.73 kcal/mol
Frequency: 0.0000
Diversity: 68.02
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((((..(((.((((((.((.(((..((((........)))).....)))...)).)))))))))....(((((.(((....((((((((((.....)))))..((....))......)))))..))).)))))((((......))))...((((((..(.....)..))))))((((.((((....)))).)))).......((((((((.((..(((((.(((.((((((((...(((....))))))))))).))).)))))...)).))))))))....(((((.....)))))..))))))))..((((((((...)))))))).......................
Thermodynamic Ensemble Prediction
...{(((((((,,(((.((((((.((.(((.,((((........)))).....)))...)).))))))))).|.{{((((((((((..((((((((((.....)))))..{{.,,,||,,,..,}}}||{..((.(((((((((......))))..)))))))..))),},,..)),))).,)))))))},,}))}|{({{...||||.((((((((.((..(((((.(((.((((((({..,(((....))))))))))).))).)))))...)).)))))))).,,.,,{{{,...}))}))),)))))))}..((({{({|...}}}}}}}|.......................

Transcripts

ID Sequence Length GC content
CCUUUCUCUCUCGCGCGCGGUGUGGUGGCAGCAGGCGCAGCCCAGCCUC… 358 nt 0.5223
Summary

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S21E family of ribosomal proteins. It is located in the cytoplasm. Alternative splice variants that encode different protein isoforms have been described, but their existence has not been verified. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human patients with sepsis demonstrated that the gene RPS21 (ENSG00000171858.18) exhibited significant differential transcript usage (DTU) between bacterial and viral infections, where transcript ENST00000343986.9 showed increased usage and ENST00000450116.6 showed reduced usage in viral compared to bacterial infection [He et al. DOI:10.1186/s12879-025-11078-z].