| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCUUUCUCUCUCGCGCGCGGUGUGGUGGCAGCAGGCGCAGCCCAGCCUC… | 358 nt | 0.5223 |
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S21E family of ribosomal proteins. It is located in the cytoplasm. Alternative splice variants that encode different protein isoforms have been described, but their existence has not been verified. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
A study in human patients with sepsis demonstrated that the gene RPS21 (ENSG00000171858.18) exhibited significant differential transcript usage (DTU) between bacterial and viral infections, where transcript ENST00000343986.9 showed increased usage and ENST00000450116.6 showed reduced usage in viral compared to bacterial infection [He et al. DOI:10.1186/s12879-025-11078-z].