Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCCUCUCCGCCAGACCGCCGCCGCGCCGCCAUCAUGGACACCAGCCG… | 1330 nt | 0.5383 |
Summary
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S28E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Forensic Context
A study in mice demonstrated that the RPS28 exhibited rapid and widespread upregulation across various cell types with increasing post-mortem interval (PMI), plateauing at approximately 36 hours, and showed the most prominent differential expression in oligodendrocytes and precursor cells experiencing greater perturbations [Guo et al. DOI:10.1016/j.ijbiomac.2025.147708]. This upregulation of ribosomal protein genes, including the RPS28, was a key transcriptomic alteration linked to PMI-induced cellular stress and was accompanied by histological evidence of activated cell death pathways in hippocampal tissue. A study in rats demonstrated that the RPS28 was identified as a differentially expressed RNA marker in the hypothalamus, with its transcript being more abundant in hypothermic animals (41 tags) compared to controls (29 tags) [Takamiya et al. DOI:10.1016/J.Jflm.2012.04.017].