Basic Information

Symbol
RPS3A
RNA class
mRNA
Alias
Ribosomal Protein S3A MFTL S3A ES1 Small Ribosomal Subunit Protein ES1 40S Ribosomal Protein S3a Fte-1 FTE1 V-Fos Transformation Effector Protein 1 V-Fos Transformation Effector Protein
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Forensic psychiatry evaluation

MANE select

Transcript ID
NM_001006.5
Sequence length
869.0 nt
GC content
0.4246

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-237.60 kcal/mol
Thermodynamic ensemble
Free energy: -255.86 kcal/mol
Frequency: 0.0000
Diversity: 231.44
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((((((((.....((.((..((((.(((.......))).))))........))..))....))))))))))))(((((((((.....)))))))))......(((((((.(.((((...((((((((.....((((((((.....))))))))......((((((.(((((((((..((.((((.............)))).))..)))))....(((((((.....((((((.(((((.((......))))))))))...)))...)))))))......(((((....)))))((((.....))))((((((.((((...(((((...((((((((.((.....(((..((((((.(((......(((((..(((((..(((...)))))))).))))).......(((.(((.....))))))(((((((((((((((((((.....))))).)))))..)))).))))).(((((....(((...))).....)))))..((......)).....))).))))))..)))....)).).)))).)))...))).)).....)))))))))).........(((((........))))).............(((((.(((..(((((...((((.((((((...((((.((((.............)))).))))(((((.......)))))..(((((...))))))))))).).))).)))))...)))..))))).)))).)))))).))))))))..((((.....)))).....)))).)...)))))))...(((((((.........)))).))).....((.(((((((........))))))).))))..
Thermodynamic Ensemble Prediction
.((((((((((((((,.((,((.,,..,|||}|||,......,,.,|(((({....}))))},}....))))))))))))(((((((((.....)))))))))......,,{{,,,...,,.....((((((((.....((((((((.....))))))))......((((((.(((((((((..((.{(((..........,..}))),}}..))))).((((((((({(((((({,,,{,|||||||{(((((((((({{.,||{{{,,...,,||,...|||||,,|{{{.,{{|{{{((((({...{((((|{,......,,||.})}|,|,...}}}})).})},,..,,||{},|||||||,,.....(((((..(((((..{({...}))))))).))))).,{{{|,,..)))})}),,)))))}||,||||||{(((((((((.....))))).))))}..)))),))}},.{{{({,{{.(({,,.|||,{...,||||,,{{...{{{||......{{{{{....)))))}}})}}.},))))),},,...{,((({.....)))}}))|{.....,},.{((((,......,))))}.,}},,,,.....(((((.(((..(((((...((((.((((({..,((((,,,,,....,,.....,}))))}))..(((((.......)))))..(((((...))))))))))).),,)).)))))...)))..))))).)))).)))))).)))))))).,(((({{{{,|||,{{((({{.{{....,,)))))},...,}|,|}}}...}}})}}))))|{,||{((,(((,,{,.....,,}))))))}.}.))..

Transcripts

ID Sequence Length GC content
CCCUUUUGGCUCUCUGACCAGCACCAUGGCGGUUGGCAAGAACAAGCGC… 869 nt 0.4246
CCCUUUUGGCUCUCUGACCAGCACCAUGGCGGUUGGCAAGAACAAGCGC… 1519 nt 0.4095
Summary

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S3AE family of ribosomal proteins. It is located in the cytoplasm. Disruption of the gene encoding rat ribosomal protein S3a, also named v-fos transformation effector protein, in v-fos-transformed rat cells results in reversion of the transformed phenotype. This gene is co-transcribed with the U73A and U73B small nucleolar RNA genes, which are located in its fourth and third introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]

Forensic Context

Research in humans and mice has identified the RPS3A as a transcriptomic biomarker for alcohol use disorder, with its expression changing in the blood of heavy drinkers one hour after a stress cue [Ferguson et al. DOI:10.3389/Fnmol.2022.1032362], while in the Australian sheep blowfly *Lucilia cuprina*, the RPS3A was identified as a highly expressed ribosomal protein in embryonic and larval transcriptomes and was successfully used as a gene marker for linkage mapping to assign loci to chromosomes [Lee et al. DOI:10.1186/1471-2164-12-406].