Basic Information

Symbol
RPS4Y1
RNA class
mRNA
Alias
Ribosomal Protein S4 Y-Linked 1 RPS4Y S4 Small Ribosomal Subunit Protein ES4, Y Isoform 1 Ribosomal Protein S4, Y-Linked 40S Ribosomal Protein S4, Y Ribosomal Protein S4Y MGC119100 MGC5070 Small Ribosomal Subunit Protein ES4, Y Small Ribosomal Subunit Protein ES4 40S Ribosomal Protein S4
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Mixture deconvolution

MANE select

Transcript ID
NM_001008.4
Sequence length
1189.0 nt
GC content
0.4550

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-361.8 kcal/mol
Thermodynamic ensemble
Free energy: -383.62 kcal/mol
Frequency: 0.0000
Diversity: 253.21
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((.(((((((((((((((((..((.(((.((..(((.(.((.......)).).)))..)).)))..))..(((((((..((.((((((((((((((....))))).))).....(((..(((((((..(((((((((((((((.((((((((..(((((((...)))..)))).....((((((((.(((((((..(((((....(((((((((..........((((((....))))))(((((((.((((((((.(((...(((((((((.(((((((((((((.(((((((((((....(((((((.(((((((((.((((((.((....)).)))))).((((((.....((((......))))....))))))(((((...)))))..(((((......))))))))))))))..(((...))))))))))....)))..)))))).))((((..(((((.((((.((((...(((((..((.(((....))).))..)))))...))))))))...(((((......))))).......((((((.....)))))).)))))..))))...(((......)))(.((((((((....)))))))).)....)))))))((((((((((.((((...))))..)))))).)))).((((((.....))))))..(((...(((((..(((((((((((...)))))))).)))..)))))....))).....(((((((((((((.(((.((((((((((.(((((((((((((.(..(((((((((...........))))))..........)))..).))))))..)))))))))).......)))))))....))).........)))))))))))))...))))))..))))))))).)))))))))))..)))))))))).))))))...))))).(((((............)))))......)))))))...........((((((........((((((((((...((.(((((....))))))).))).)))))))........)))))).....)))))))).....)))))..))).))))))))))).....)))).)))).))).))).))))))))..))..)))))......)))).)))))).....))))))).).))))..
Thermodynamic Ensemble Prediction
.{((((,(((((((,(((((,(((,(((,{{{,||,.{((,{,((.......|}.|.}}}..)),)||{,{{,|,}},))))}||,,..,,.((((((((....))))).))}({{{(..(,{((..((((((,...,(((((((((.((((((((..(((((((...)))..))))....{((((((((.(((((((..(((((....({(((({{(,,,,,{{.{,((((((....)))))),||,|||.((((((((.{({...(((((((((.(((((((((((((.{(((((((({(....((((((,.(((((((((.{(((((.((....)).)))))}.((((((..,..((((......))))....))))))(((({...}))))..(((((......)))))))))))))).,(((...))))))))))....})).,)))))).)}{{{{,,(((({.((((.((((...(((((..((.(({....})).))..)))))...))))))))...(((((......))))).......((((({,....}))))).})))}..)))),|,{{{......})}(.((((((((....)))))))).),...))))))){(((((((((.((((...)))).,)))))).|))|.((((((.....|}}}}},|||||..(((({..{{,{((((((|...)))))))}.,}}..)))))...,}}}},,..(((((((((((((.,((.((((((((((.(((((((((((((.(..(((((((((...........))))))..........}))..).))))))}})))))))))).......)))))))....,}}.........)))))))))))))...))))))..))))))))).))}))))))))..|||||}|}}}.}})))).,,)))}},(((,,.....,,}}...}})}),.....)))))))...........((((((........((((((((((...({.(((((....))))))).))).)))))))........)))))).....)))))))},}...))))}.,))).)))))))))))))))..))).))),.)))})..{||||||||,|||{.||.......,.,))),)))))),,...))))))).}.})))..

Transcripts

ID Sequence Length GC content
CUCUUCCGUCGCAGAGUUUCGCCAUGGCCCGGGGCCCCAAGAAGCACUU… 1189 nt 0.4550
Summary

Cytoplasmic ribosomes, organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes ribosomal protein S4, a component of the 40S subunit. Ribosomal protein S4 is the only ribosomal protein known to be encoded by more than one gene, namely this gene and ribosomal protein S4, X-linked (RPS4X). The 2 isoforms encoded by these genes are not identical, but are functionally equivalent. Ribosomal protein S4 belongs to the S4E family of ribosomal proteins. It has been suggested that haploinsufficiency of the ribosomal protein S4 genes plays a role in Turner syndrome; however, this hypothesis is controversial. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the RPS4Y1 serves as a male-specific RNA marker for forensic sex identification, being correctly scored as "observed" in 94% of male body fluid and organ tissue samples with no false positives [van den Berge et al. DOI:10.1016/j.fsigen.2016.10.018]. It was successfully incorporated into multiplex RNA assays, enabling positive identification of male cellular material in mixtures and degraded exhumed tissues, and it is specifically detected in semen and male blood for body fluid and sex identification [Li et al. DOI:10.1093/fsr/owad003].