| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCUUCCUGUCUGUACCAGGGCGGCGCGUGGUCUACGCCGAGUGACAGA… | 741 nt | 0.5803 |
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S7P family of ribosomal proteins. It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the RPS5 was listed among the top 15 most highly expressed housekeeping genes with a low coefficient of variation across individuals, indicating it exhibited low variation and appeared insensitive to factors like genetics, environment, age, and gender [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003].