Basic Information

Symbol
RPS5
RNA class
mRNA
Alias
Ribosomal Protein S5 40S Ribosomal Protein S5 US7 S5 Small Ribosomal Subunit Protein US7
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_001009.4
Sequence length
741.0 nt
GC content
0.5803

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-269.60 kcal/mol
Thermodynamic ensemble
Free energy: -283.01 kcal/mol
Frequency: 0.0000
Diversity: 185.94
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......((((((......))))))(((.(((((....(((((.((((.((.(......))).))))))).))..))))).)))((.(.(((((((..((((((((((((((..((((((..........))))))....((.((...(((((((((((.((((.(((..(((((((((((.......))))))....))))).((((.....))))((((((...)).))))(((((....)))))....(((((.((...))...((((..((((((((((...........))))))))))..)))).((((......))))..))))))))))).).)))))))))))..))...))((((((.......((((((....(((.(....))))..))))))..((((((......)))))).((((((((.((((((((...((.((((....((((((((((.(.((((......))))..).))).))))))).....(((((.((((.((..((((....))))...)).))))))))).)))).))...))))))))........))))))))..((((.(.((((((.(((.....)))...)))))).).)))))))))))))...))))...........((((..((((.......))))...)))).))))))).........)))))))))).......(((.((((((....))))))...)))...
Thermodynamic Ensemble Prediction
......{{(.,,....,,|||{(((((.(((((....(((((.((((.((.(.....,})).)))}))).))..))))).}||((,{,(((({((,,((((((({(({{{{..((((((......,.|,}}}}}}..,.({,{|.},(((((((((((.(((,{(((..,(((,((((((.......)))))).}},||,|..(((({{{..||.{((((({...}).))))|||||}}}})},))....(((((.,,...}}...((((..((((((((((...........))))))))))..)))).((((......))))..))))))))))).).)))))))))))..,|.{{{{({{(((.......,{{{{|,,..|||,|....,,))},))}||},.(((({,..,{,,}}}|||.((((((((.((((((((...((.((((....((((((((((,(.((((......)))).,).))).))))))).....(((((.((((.{{..((((....))))...)).))))))))).)))).))...))))))))........)))))))).}||||,({((((((,(((.....))}...)))))}.)}||||||||,.,{{{{.,.,,.....,..,.}))},}}}},}))}}}),)})},..}.)).})))))).......,.)))))))))).......,{(.((((((....)))))).,.))).,.

Transcripts

ID Sequence Length GC content
CUCUUCCUGUCUGUACCAGGGCGGCGCGUGGUCUACGCCGAGUGACAGA… 741 nt 0.5803
Summary

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S7P family of ribosomal proteins. It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the RPS5 was listed among the top 15 most highly expressed housekeeping genes with a low coefficient of variation across individuals, indicating it exhibited low variation and appeared insensitive to factors like genetics, environment, age, and gender [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003].