Basic Information

Symbol
RPS8
RNA class
mRNA
Alias
Ribosomal Protein S8 ES8 S8 Small Ribosomal Subunit Protein ES8 40S Ribosomal Protein S8 OK/SW-Cl.83
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_001012.2
Sequence length
778.0 nt
GC content
0.4961

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-234.00 kcal/mol
Thermodynamic ensemble
Free energy: -250.18 kcal/mol
Frequency: 0.0000
Diversity: 241.22
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
............(((((((((....))))))))).........(((((..(((((.(((....))).))))).....)))))..(((((..(((...(((((((((.((((((.((((((..(((....(((..((((.(((((((...)))))))(((((........)))))(((((((((.............))).)))))).((((........)))))))).)))...)))...))))))..)))))).(((((((((((((((((((..((....(((..((...))..)))))..)))))))).)))......((((.(((((.(((((......)))))..))))))).))(((((.......)))))...(((((......)))))))))))))........)))))))))..(((((((((...(((..((((.(((((.((((.....(((((.............))))).......((((..(......)..))))........((.(((........))).))))))..)))))......))))..)))...))))))))))))..)))))...(((((........)))))(((((((((((.....))))((((((((((((.(((....))).)))((((........(((......))).......))))...)))))))))...((.((((((.((((((................)))))).)))))).)).................)))))))..
Thermodynamic Ensemble Prediction
,...........{{(((((({....|||||||}},...,.,,,((({(,.(((((.(((....})).))))).....|||||..{||,|||||,,..{{(((((({.((((({.({{{{{..{,,,,,{(((..{,,,.(((((((...)))))))(((((,.....,.)))))(((((({((,,..,,...,,..)))})))))),((((,,......}}|||,|||}||,,,|}}..,}}||||..}})))).(((((((({((((((((({..{,...,(((..({...})..))))}..)))))))).))}....,,((((.{((((.(((((......)))))..))))})).))||(((.......)))))...(((((,....})))))))))))))........}}))))})){{(((((((((...(((..((((.(((((.(((,.....((((({{........,..})))).......{(({..{......}..}}},.,,.....{,.{((........))}.))))))..}))))...,}.))))..)))...))))))))),)),,}))}},,.|||||}....,|{|||}}|||{{||||{|..,.,)))}|.((((,..{{,,,{{{.{{{{,..,},||},..}}...||},.,.{((((((({{{.,,,}},}}))))))}|,,,,,,,,{,,,,{}}|},,,}},,.}}})},,}}))}},,.}}}}))))||,,|}}.,..}}}.},}}}})))},.

Transcripts

ID Sequence Length GC content
GUUUUACAAACCGAACCGUGAAUCUUUGCGGUUUCUCUUUCCAGCCAGC… 778 nt 0.4961
Summary

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S8E family of ribosomal proteins. It is located in the cytoplasm. Increased expression of this gene in colorectal tumors and colon polyps compared to matched normal colonic mucosa has been observed. This gene is co-transcribed with the small nucleolar RNA genes U38A, U38B, U39, and U40, which are located in its fourth, fifth, first, and second introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that post-mortem interval (PMI) induces rapid and widespread upregulation of ribosomal protein (RP) genes, including the RPS8, across various brain cell types, plateauing at approximately 36 hours [Guo et al. DOI:10.1016/j.ijbiomac.2025.147708].