Basic Information

Symbol
RSL24D1
RNA class
mRNA
Alias
Ribosomal L24 Domain Containing 1 RPL24L HRP-L30-Iso C15orf15 RPL24 L30 Probable Ribosome Biogenesis Protein RLP24 Ribosomal L24 Domain-Containing Protein 1 Homolog Of Yeast Ribosomal Like Protein 24 Chromosome 15 Open Reading Frame 15 60S Ribosomal Protein L30 Isolog Ribosomal Protein L24-Like My024 Protein RLP24 TVAS3
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_016304.3
Sequence length
1889.0 nt
GC content
0.3409

Transcripts

ID Sequence Length GC content
ACUUCCUCUCAAGCUUGGCGUUUGUUUGGUGGGGUUACACGCGGGUUCA… 1889 nt 0.3409
Summary

This gene encodes a protein sharing a low level of sequence similarity with human ribosomal protein L24. Although this gene has been referred to as RPL24, L30, and 60S ribosomal protein L30 isolog in the sequence databases, it is distinct from the human genes officially named RPL24 (which itself has been referred to as ribosomal protein L30) and RPL30. The protein encoded by this gene localizes to the nucleolus and is thought to play a role in the biogenesis of the 60S ribosomal subunit. The precise function of this gene is currently unknown. This gene utilizes alternative polyadenylation signals and has multiple pseudogenes. [provided by RefSeq, Jul 2012]

Forensic Context

A study in human pediatric sepsis patients demonstrated that the RSL24D1 exhibited increased polyadenylation in viral compared to bacterial infection samples, identifying it as a candidate gene for differential polyadenylation analysis between infection types [He et al. DOI:10.1186/s12879-025-11078-z]. A study in humans analyzing blood samples from severely burned patients identified the RSL24D1 as a Temporal Expression Profile Gene exhibiting a significantly decreasing expression trend from 0 to 7 days after burn injury [Wu et al. DOI:10.1016/j.burns.2018.08.022].