| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUUCCUCUCAAGCUUGGCGUUUGUUUGGUGGGGUUACACGCGGGUUCA… | 1889 nt | 0.3409 |
This gene encodes a protein sharing a low level of sequence similarity with human ribosomal protein L24. Although this gene has been referred to as RPL24, L30, and 60S ribosomal protein L30 isolog in the sequence databases, it is distinct from the human genes officially named RPL24 (which itself has been referred to as ribosomal protein L30) and RPL30. The protein encoded by this gene localizes to the nucleolus and is thought to play a role in the biogenesis of the 60S ribosomal subunit. The precise function of this gene is currently unknown. This gene utilizes alternative polyadenylation signals and has multiple pseudogenes. [provided by RefSeq, Jul 2012]
A study in human pediatric sepsis patients demonstrated that the RSL24D1 exhibited increased polyadenylation in viral compared to bacterial infection samples, identifying it as a candidate gene for differential polyadenylation analysis between infection types [He et al. DOI:10.1186/s12879-025-11078-z]. A study in humans analyzing blood samples from severely burned patients identified the RSL24D1 as a Temporal Expression Profile Gene exhibiting a significantly decreasing expression trend from 0 to 7 days after burn injury [Wu et al. DOI:10.1016/j.burns.2018.08.022].