| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGGCGUGUUCGCUGUUCAGUGCCGGUGUUGCAGGGAGUGAGGGCAGCU… | 3730 nt | 0.4228 | |
| AGGGCGUGUUCGCUGUUCAGUGCCGGUGUUGCAGGGAGUGAGGGCAGCU… | 3618 nt | 0.4182 |
This gene encodes a protein that is involved in the Ras signal transduction pathway, growth inhibition, and nerve-growth factor induced differentiation processes, as determined in mouse and human cell line studies. In mouse, the encoded protein was initially isolated based on its ability to inhibit v-Ras transformation. Multiple alternatively spliced transcript variants for this gene have been reported; one of these variants was found only in glioma tumors. [provided by RefSeq, Jul 2008]
A review of human studies summarized that the RSU1 is part of a six-protein panel (including THBS1, C3, ALDOA, GSTO1, and TLN1) demonstrating high diagnostic accuracy for sudden cardiac death risk in patients with hypertrophic cardiomyopathy when analyzed using ultraperformance liquid chromatography-tandem mass spectrometry [Raluca-Maria Cătinas; Sorin Hostiuc DOI:10.3390/ijms26146818]. A study in humans identified Ras suppressor protein 1 (RSU1) as part of a six-protein panel, including THBS1, C3, ALDOA, GSTO1, and TLN1, that demonstrated high diagnostic accuracy for predicting sudden cardiac death risk in patients with hypertrophic cardiomyopathy using UPLC-MS/MS [Cătinas et al. DOI:10.3390/ijms26146818].