| ID | Sequence | Length | GC content |
|---|---|---|---|
| CACAUUGACCCAACCGCAGUGAAGGGAGAGCGCCUCCAGUGGUGUGGUG… | 4068 nt | 0.3896 |
This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the RTN4 was differentially expressed between monozygotic twins, belonging to the least variable category of housekeeping genes and classified under signaling and communication [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003]. In a rat model of traumatic brain injury, the RTN4 was upregulated following a severe (50% Lagrangian) stretch injury, where it targets and positively regulates RhoA, implicating it in a specific neurodegenerative pathway [Di Pietro et al. DOI:10.1089/neu.2009.1095].