Basic Information

Symbol
RTN4
RNA class
mRNA
Alias
Reticulon 4 NOGO KIAA0886 NSP-CL ASY Neuroendocrine-Specific Protein C Homolog Neurite Outgrowth Inhibitor Reticulon-4 Foocen NOGOA NOGOB RTN-X NSP Neuroendocrine-Specific Protein Neurite Growth Inhibitor 220 My043 Protein Nogo Protein Human NogoA Reticulon 5 Reticulon-5 NI220/250 Nbla00271 Nbla10545 RTN4-B1 RTN4-B2 RTN4-A RTN4-C NOGOC
Location (GRCh38)
Forensic tag(s)
Individual identification Mechanical injury analysis

MANE select

Transcript ID
NM_020532.5
Sequence length
4697.0 nt
GC content
0.4386

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1323.10 kcal/mol
Thermodynamic ensemble
Free energy: -1414.60 kcal/mol
Frequency: 0.0000
Diversity: 1502.74
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..........((((((..(((......)))....))))))(((((((...))).........(((((((...((((......((..(((((((((...(((.(((.....))).))).))).)))))).))....(((...((((((((((((((...(((((((((((......)))))(((((((((((...(((......))).((..((((((..(........)..)))).))..)))))))))))))(((((......((((((((..((((.((.(((((.((..(.(((.(.(((((((((((.((..(((((((((((((....)))))).)))((((((.(((...((.(((....(((((.(((((((...((((......)))).........))))))).)))))...)))))....)))..)))))).....(((......))).((((((((.(.(..((((.(((.((.((((.......)))).)).)).)...))))....).).))))))))..))))))))))).)))))).).))).)..))..))).))..))..))))..))))))))..(((((.(.(((.(((....))).(((...((((((.....(((......))).....))))))....)))))).).))))).((((........)))))))))(((((((.....)))).)))...((((((((((..(((((...((((.........))))...))))).......)))......)))))))))))))....))))...))))))((((((((((.........))))).)))))...(((((((......(((((((((...(((((...((..(((((.((((.......))))......(((((((((....))).))))))...(((((.....))))).............)))))..))..)))))...)))))))))......(((((........)))))........((((.(((.......))).))))......((((.(((......))))))).......((((...))))......)))))))......)))).)))...............((((((((((((((((..((((........))))((((((..(((((((.(((((((......)))))))......)))))))..))))))((((......))))....(((((........)))))..(((((.(((((((..(((((...(((((((((((((((((((((.(..(((...(((.((((.(((....((((....((((((.((((..(..((((......))))..)((((.(((((...((((((((((((((........))))..........)))))).).))).))))).)))).((((.((((..........))))...))))........))))))))))))))...))))))).)))...)))..))))...(((((((((.....)))))))))..........(((((........))..))).......)))))))))))).))))))...)))))((((......((((((...................(((.((((((((.......(((.((..(((((((.(((.(((.((..(((((.....((((((......))))))(((.((((..(((((.((((((((..............(((((((((..((((..(((((......(((....)))((((((((((((.........(((((.((((....(((.((((((.(((((..((...(((((....))).))...))......))))).))))))...))).......((((((((...))))....)))).))))))))).......)))))..)))))))..)))))..))))..)))))..)))).....((((((((((((((((.........(((.(....).))))))))))))))))))).....((((((((.....(((...((((..(((........))))))).)))...))))).))).................(((((((((.(((((.....(((......))).(((((......................)))))................((((........)))).(((((...((((.....(((((((((.......(((((......))))).((((((((((((((((....)))......(((((.(((((((.....((....(((((((((((.....(((((((....((((((((((((..((((((.(((((((((((.(((((....))))).))))...)))..))))(((((...((..((......))..)).)))))(((..(((((((...)))))))..))))))))).)))..(((((((......((......))....(((((.(..((...))..).)))))))))))))))))))))..))))))).((((.(((((............))))).))))(((.(((((..((((..((((..((((......)))))))).))))..))))))))((((((((((......((((((........))))))....((((((((((....((((((((((....(((((.(((((((((..(((....)))..))))))))).........((((((((....))))))))..............((.(((.((.....((((((((...((((((((....))).....((....))...)))))...)))))))))).))).)).............(((..((((....))))..))).((((.....))))..)))))..))))))))))(((.......)))...(((((((.((((((((((..(((..(((((.(((((((((.(((((((((((.((...)).)))))))))))((((((...............))))))(.(((.((((...........)))).))))..(((((.....((((.(((((....)))))........((((((..((((((......))))))))))))))))))))))))))).).)).)))))..)))....))))))..))))...))))))).))).))))))))))).))))))...(((.((((.((......)).)))).)))..((((((((...((((.((.....(((((..((((((((....)))).))))))))).))))))...))).....))))).....))).))))...))))..)).....))))))).))))))))))))))))))(((..(((.....)))..))))))))))))........)))))))))))))).).))))))))...)))).)))).)))))...)))).))))))))..)).))).))).)))))))..)).)))))).))))).)))..)))))).......))))....))))))).)))))))))))....(((((((((.((((....(((..((((..((((((......))))).)..))))....................(((.(((((..((((((.(........).))))))..))).)).)))...........)))....)))).)))))))))))))))))))..))))(((.((....)).)))...)))))))(((((((.........)))))))(((((((((((.((((((((((......((((((((((((((((((((((.....((((((.((((...........((((((((......((((((((((.............(((((((((((((.......)))))..))))............(((((((.((((..(((((((((...........))))))))).)))).))))))).(((((((.....)))))))..))))))))))))))(((.................))).....((((((((((((((((((.((((.(((((.((.....((((((((((((....(((((((((.(((.....(((.((((((((.((((((((..(....)..)))))))).)))))))).))).(((.((.((((((.......)))))).))...)))................((((((((((((((((((...)))...(((.((........))...))).......(((((.(((((........))))).)))))..)))))))))))))))....(((......)))....))).))))))))))))))).......))))))..)).)))))....))))...))))))....................))))))))))))..)))))))))))).))))))....))))).)))).(((..(((.......(((((((((((....))))))....))))).....))))))..............)))))))))))))........(((((((........))))))).)))))))))))))))))).))).....((((..............))))...)))).....
Thermodynamic Ensemble Prediction
...{,,..((((((((..,,,......|||{...,|||||.(((({(({{{{{(((({...((((((((.....,.....{((((.(,((((,,,...|}|})}}..)))))|.(((((.,..))))).}}....{((,{..(((((,.,{{,||,.,.||||{(((((......)))))|((((((((((...(((......))).((..((((((..(........)..)))).))..))))))))))))))}))..}.,}})),))}})},}|)),)).{{(((.,,..,.|||.|.(((((((((((.((..(((((((((((((....)))))).)))((((((.,,(.({.....,((((.(.(((((((({((.,(,{{.,,...}|||....,..,,}))))))))))))....))))....,,)},)))))).....(((......))).((((((((.(.(..((((.{((.((.((((.......)))).)).)).)...))))....).).))))))))..))))))))))),,)))))}),})).)}}))}})),..)))))))))))}}...((((((((({{{.({{,({((({{..{||.(((((,(.,{((.,.,,|}}.,,...)))}}..))}|.{{{...........,))}.((((....)))).))))}))}.}||||||({{((({{|,.{{{{,,.,{|||{{{{{,(((({.,,((((,{{......}}}}...}))}}.......||,,,,|,||||||{{{{{{||....,},||,,|||}||{(((((((((.........))))).)))))..}|||||||}},.,.(((((((((...(((((.,.((..(((((.{(({.......}}},......(((((((((....))).))))))...(((((.....))))).,......,,...)))))..))..)))))...)))))))))..,{{.(((((,{...,}.))))).}}}....((((.(((.......))).)))).....{(((,.,,({{{{{{||||,}|.,,....((((...)})),....,|||,|||,.{{{,{{|||,,,.....{{{{,,,...{{,,{(({{,((((((..{{{{,,,,.,,,},,|((((((..(((((((.(((((((......)))))))......)))))))..))))))},,{...{((({{,.,..,,,,|..}}}}},,}}},..{((({.((((((({,(((((...((((({,{{|||||{{{{.{{{{,,{{{,,.(((.((((.(((,,.,((((....((((({.((({.,{,.{{((,,....}|}}..}{(((.(((((...{((,((((((((((........))))..........)))))).,.}}}.))))).))),.(((,.((((..........)))}.||}|||........))))}))))))))}.,,}}}}}}}.))).,.,,}|...,,},.(((((((((.....)))))))))......,,|||||||,,}||..,|},|}}},......}}}||||||}}},|)))))...}}}||((({......{((({{.{..................,{.{((((((,....,,,{{{,{{,.{{{{{((.(((,(({,(({{((,,({.{{{((((((.,{{{.||||||,((,({(({{{{{{{}|||{{,,|.,,...........,((((((((,{({{({{(,((({....|{||,,,,|||((((((({{{,,...||.||,|(((({((((..,{(((.(({{{{.{|{||,,}..|}||.....}}))}.},...},......}}})).}))))}.,.},,...,.,.|{{,{(({,..||}|,||,}|||{||}|||}}}|,.{{{,|||||{,|||||||..|||,|,,|}}},.|}|,|,,|}}}|....((((((((((((((((.........(((.{....}.)))))))))))))))))))..|..,,(((({{......,.((((((({,((({....{((((....)}))}..((((.((((......................))))))))((((...}}}}.......(((.{(((.,,.{{(({.,...{,.{(((({{((............)))))))}..,......,...})}))}.,,|{|||.,||,.{|||||{|,,....(((({....,,})))){((({{,||||{{{,{,,,..|{{{{....|||||.,{((((...,,{,,.,,|},{,|||},,,,,...(((((((....(((((((((....,..((((((...,,(((((((((,,,.{{(|,|,.|||.....))}.,}},|||{,..{(({(,{.....,,}.,}.})))),.,.,.{((((((...)))))))}.}}))))))))),.))))))..}......,{......}},.{.(((((.(,.((...)),.),)))))},,....)))))))))..))))))).||||}|,|||,,..,}},,.,}))})),)))).}}||||||..{{{|,,(({.,{((((,....,)))))))).)))),,))))}}}}}},|||,|||}}.,||||||||}|.(((((({.{(((....}}}}...}}}}}}|,{,,,(((({,...|}))}},{((((((..{{{....)))..))))))|||{{{{....,((((((((....)))))))}}}............,..}||||,,.{{{(,,,,,,,.}}|||||{{(....))).....||,..})}...))))),,}))))))}},,||,,,|||,,,,..}}}...|||,,||{{||,,|}}}..,...{{((.....}})}.,||{|{,.||,,}}}}}),,,,||||}}}}.....,|||||.,|||{{{{{...|(({{{(({..,||,,,,.,.(((((((((((,({...,,})))))))))))||||||},,||,..,,,,..,||||||..|,}}}|||}},,,......}}||||||{,.{{{{{.....{{||.(({{{....,||||{{......{{||||}|((((((.....,}))))))})))}}}))))))},))))).}.,,.,,}}},,},,||,,||}}|||||}}}},})|}},})})|)|)}}},}}}},},)}}))}}}.(((.((((.((......)).)))).)))..||||{{||,}}|||||{{,{,..(((({..(((({(((....})))}})))})))}.,,{{{{..{|||{{{..||||...,..,,.}))),}})))))..)))).,{|||||||.||||||}}}}}}})))))},|,.,||},,,,}}),}},})))),}|||..,,})),}}},,))},}}}}}}).)})}))))},.}))}.}))},}}))).,,)}))}))}))))),,))}))}.}||{|||,,,,,}))})))))).))))).))),.}))))),,,.,},)))}...,))))))).))))}))))))..,,||{{||||,,||||,,..|{{,,{{{||.|{{{((,.....})))).},.}))),.........,}},.....,(({.(((((..((((((.|........}.))))))..))).)}.}))}}}}}}}....,))},..,,,,.}}}})))))}}}}}}}},},})))},|})))}},,)}.....)))))))))(((((((.........))))))),((((((((((.((((((((((.,.,{,((((((((((((((((((((((.....((((((.((((...........{(((((({...|,.(((((((((((..,,...,,,...||,{((((((((.......)))))..))))............(((((((.{(((..(((((((((...........))))))))).)))}.))))))).(((((({.....})))))).,}},)))))))))))|||.........................((((((((((((.(((((.((((.(((((,({,,{{.((((({,{(({{....{|||{{{{{.|||,.}}.(((.((((((((.{(((((((..(....}..)))))))}.)))))))).))){(((,{,,(((((,...{(({||{(({{{|,,,,,..,|||,.,,,.,,,,.|||||{|||||{||||||..,)))},.{{{,|{},,,....,|,,.|||.......{{{((,{((({........))))).))))),.}}}})}}||||}}}}....{||,,,...))),||||,|.}},},)))))}}|}},,,,,..}}}})},,}},}}})),...)))).))))},,|,...............,,..))))))))))))..))))))}})))).))))))....))))).)))).,,{..{{(...,,..{{(({(({(((,,..|}}}}}...})))}),,,.,)))))}..............})))))))))))).},,,...(((((((........))))))).))))))))))))))))))})}|{{{..,{{{....,.........)))),,,}}}......

Transcripts

ID Sequence Length GC content
CACAUUGACCCAACCGCAGUGAAGGGAGAGCGCCUCCAGUGGUGUGGUG… 4068 nt 0.3896
Showing 11 to 11 of 11 entries
Summary

This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the RTN4 was differentially expressed between monozygotic twins, belonging to the least variable category of housekeeping genes and classified under signaling and communication [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003]. In a rat model of traumatic brain injury, the RTN4 was upregulated following a severe (50% Lagrangian) stretch injury, where it targets and positively regulates RhoA, implicating it in a specific neurodegenerative pathway [Di Pietro et al. DOI:10.1089/neu.2009.1095].