| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCUUCCUGAGAAACGAGCAAACCUGAAAGCUACUCUCUCAGCUUCAGA… | 1501 nt | 0.4497 |
Predicted to enable olfactory receptor binding activity. Involved in detection of chemical stimulus involved in sensory perception of bitter taste and protein targeting to membrane. Located in cytoplasm. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that the RTP4 was identified as a specifically expressed core differentially expressed gene in the 12-hour post-wound group, where it was down-regulated, and its expression pattern was associated with wound age estimation [Zhu et al. DOI:10.1016/j.legalmed.2021.101982].