| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCCGGCGGCUGCAGAUUGACGGGACGAGAUGGUCCUGGCAGGGCUCAU… | 7647 nt | 0.4334 | |
| CUCCGGCGGCUGCAGAUUGACGGGACGAGAUGGUCCUGGCAGGGCUCAU… | 7830 nt | 0.4309 |
This gene encodes a large protein whose specific function is unknown. Absence of the orthologous protein in mouse results in embryonic lethality with deficient axial rotation, abnormal differentiation of the neural tube, and randomized looping of the heart tube during development. In human, mutations in this gene are associated with polymicrogyria with seizures. In human fibroblasts this protein localizes at the ciliary basal bodies. Given the intracellular localization of this protein and the phenotypic effects of mutations, this gene is suspected of playing a role in the maintenance of normal ciliary structure which in turn effects the developmental process of left-right organ specification, axial rotation, and perhaps notochord development. [provided by RefSeq, Jan 2013]
A study in mice demonstrated that acute alcohol exposure during neurulation induces rapid transcriptomic changes in the rostroventral neural tube, with the RTTN gene being down-regulated (-0.33 Log2FC) 2 hours post-exposure, indicating its role in cilia-related processes and regulation of mitosis [Boschen et al. DOI:10.1016/J.Alcohol.2022.09.001].