Basic Information

Symbol
RYR2
RNA class
mRNA
Alias
Ryanodine Receptor 2 ARVC2 VTSIP Cardiac Muscle Ryanodine Receptor-Calcium Release Channel Ryanodine Receptor 2 (Cardiac) Type 2 Ryanodine Receptor ARVD2 RYR-2 Arrhythmogenic Right Ventricular Dysplasia 2 Cardiac Muscle Ryanodine Receptor Cardiac-Type Ryanodine Receptor Kidney-Type Ryanodine Receptor Islet-Type Ryanodine Receptor VACRDS HRYR-2 RyR2 RyR
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Postmortem interval inference

MANE select

Transcript ID
NM_001035.3
Sequence length
16583.0 nt
GC content
0.4629

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-5134.6 kcal/mol
Thermodynamic ensemble
Free energy: -5453.03 kcal/mol
Frequency: 4.11e-225
Diversity: 5349.56
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((((((((..(((((..((((((.((.((((((.(((.(.((....))).)))))))).).)))))))))))))..))))))))))..(((((.((((.((((.(((...))))))).)))).))))).((((...........))))..(((((((((((((((((((((((((.....)))))))......(((.(((((((...((((.(.((((((((.....((..((((...))))..))..........(((...))).)))))))))))))..))))))).)))((((((.(((...)))))))))..))))))))))))).....(((..(((((((((.(((((...((...(((((((((....))))))..)))...))....(((((((((.(((...(((..(((((((..........((((....)))).(((((.((((((((..(((........((((((((((.........)))))))))))))....)))))....))).)))))..))))))).))).((((.......)))).))))))))))))((((((((((.((((.((((((.(((..((((.(((((((((((((((((...((((....))))...((((((((.....((((((((((..(.((((..(((((..(((((.((((((.(((...((((((.....))))))..)))..))))..)).))))).(((....((((((...((.(((((((((.......))))))))))).)))))).....))))))))..)))).)..)))))).))))((((......)))).....((((((..........(((((((((..((.((((((((((....(((.(((((.....))).)).)))..(((((....)))))..(((((((.....(((..(((((.((((((.((...)))))))).))))).))).....((((.....))))((((((..(((((((((((....))).))))))))..))))))(.((((....)))).)..((((((((...(((((...(((.((((.(((((((.(((((((....(((.((((...)))))))..)))))...)).))))).)).)))))))..)).)))..))))))))..)))))))((((........)))).)))))))))).)).....))))))).))(((((..((..((((......)))).))..)))))..........)))))).((((((((..........((((.((......)).))))..((((((((((((.(((....)))..)))))).....))))))........(((.((((((((.((.((((.............))))..))..)))))))).)))..(((((...(((((((...(((........)))))))))).)))))...))))))))..((((((((..((((......((((((((.(((..((.....)).))).))))))))......))))..))))))))((.(((....))).))...(((((.......))).)).))))))))((((..((.....))..))))((((((..((((.((.....)).)))))))))))))))).))))))))))).....(((((((.((....)).))).))))((((((((.............))).)))))......((((((.((((((..((((((.......(((((((((((((............(((((((...((((..........))))(((((..(.(((.(((((.((....)))))))..))).)..)))))..(((((((((...(((((.((((.(((.(((((((...(.(.........(((.(((((((...((((((....))))))....)))))))..))).........).)...))))))).)))..)))).)))))..))))))))).........))))))).)))))))))..(((((((..((((((...........))))))..))))))))))).............(((((((.(((.((....)).))).)).))))).........................))))))..))))))))))))..))))..))).)))))).)))).............)))))))))).((((((((((((((..........)))).)))))...)))))...((((((((...(......)...)))))))).............(((((...((((((((..((((((((........(((((((((......)))))..))))((((((....))))))...)))).))))....))))(((((((((..((((((((......(((.....)))((((((.((((((((.((.(((.(((((((...((((.((((((.((((....(((......((((((.(((.((((((..(((((((((((((...((((...(((((((..............(((((...((((((((((....)))))))).))...)))))..((((((.....))).)))(((((.......((((((...)))))).(((((........)))))..((((((((((((((((((.(((((.....(((((((((((((.......((.((((((((....)))))))))).(((((((.............(((((((.((((((((((.(((((.....(((((.((((((...(..(((((.((.......((.((((.(((((.((...................((((((.(((((((...((((((......(((.(((...)))..))).........))))))...)))).))).))))))((((......(((............)))......))))...........)).))))).)))).)).......)).)))))..))))))).)))))...((((....))))))))))))........))))))))))))))))))))).(((.(((....))))))...................(((......)))))))...((((((((....((((.(((((((.(((.....))).))).)))).)))).))))))))........(((((((..((...........(((....)))(((..(((((((((.((...((((.((((..........))))..((((((..........))))))....((((((((....(((((.....(((.(((((((((......((((((((((((((((((.(((((((((..((((.(((..((((((..((.....))...))))))..)))..)))).)))))).)))....)))...))))....(.((((((((...)))))))).))).).))))))))...(((((.....((((..(((...(((....))).)))..)))))))))....((((.(((((((.((((....(((((((((..(((.((((((((.((.....((((.(((((((.(..(((((((((..............(((((((((((..........(((.(((.((((((((((((((........))))))))...)))))).))).)))..(((((.(((......)))...))))))))))))))))(((..(((..............((((((((((((..(((((((((((((((.((((.(.(((......))).))))).))))))).....(((...(((((((.(((((((((((....((((........))))...)))))(((......)))((((((((.(((((((((...(((((((..(((.(((.(((((.(.((..((((..(((....)))..)))).)).)))))).........))))))..))).))))...))).))))))))).)))))(((......))))))))).)))))))))).((((((((((((((((.......(((....((((...........))))....)))(((((((.(((((...((.((........)).))...)))))...)))))))..)))))))))))...)))))..(((.....)))............))))))))....))))))..))))))(((((((((((.....(((((......((((((((.((((((..(((.(((((((((((((((.....))))).(((((((((.((((.(((.((((....)))).....)))..)))))))))...))))...))))))...((((......))))...(((((.((.....))))))).........)))).)))..))))))...)))))))))))))......))))))))))).............))).)))..((.(((((((((.(((.((..............((((((((((......((((..............((.(((((....(((..(((((.(((((..(((((..(((.(((.((.((((..((((....((((..(((((((((........)))...)))))).....)))))))).)))).)).))).))).)))))..))))).)).)))((........))....)))....))))).)).((.(((..((((.((..((((....))))))))))..)))..))......))))))))))))))..............)).))).))))).)))).)))))))))))..).))))(((((..(((.(((((...))))))))..)))))......(((..(((...)))..))).........)))))))(((.....((((..((.....(((((((..............))))))).......))..))))..))))))))))))))))..))))....).)))).......))))))))))).))))..))))))))).))))))))....)))))).))))))...)).))))..(((((((((((((((....(((....((.((.(......).))))))))))))))))))).)))..)))))..)))(((((((((((.(.((.(((((((((((((((((...(((...(((((((...(((((((((.(((((.(((((...((.(((..........))))).))))).)))))..)))))..))))..(.(((((......))))).)(((((((((((((((((((((.(((((....(((((.((((((..((((.(((((.((.(((..(((..(((.((..(((((.(((((.(((((((.((((..(((.((((..((((.((............)))))).....))))..)))..)))).......(((((((((((((....(((((((..............(((((((((((((......(((((...(((((...((....))...))))).)))))..(((..((((.(((((((..(((((((((.((((((.(((((....))))).......((((((........)))))).......................)))))).)))).))))).......(((((.......)))))((...))....)))))))..))))...)))..)))))...)))))))).))))))).....))).))).))))))).((((((((((..(((((((((..(((.....)))....(((((((((((((((((((((((((((((.(.((((((((.(((((.((.....((((.(((((((....(((((((((((((((...((((((..(((((((..((.((....((...((((((...((((.......))))))))))...))...)).))...)))))))...))))))...))).(((((...)))))(((((((..((((((.(((((....)))))...(((((((((.(((......(((..(((((.(((...))).)))))..)))..((((........)))).((.(((((...((((.....((((.((((......))))......))))))))........((((((.(((((..(((((((((....((((..........((((((((........))))...))))....((((((((...........))))))))...))))..)))))......))))....))))).))).)))....((((((((((((((...(..(((((....)))))..)(((((((((....((((((......(((......((((.............))))...))).(((((((((((((......))))....))))).))))....((((((((((.((((......)))).))))))))))((((...((((((..(((((((((((((((((((((.((.((.((((...((((((((.(.(((.((((((((((.....))))))..)))).).))...........((((((((((.....))))).))))).(((((((((.....(((((.((...((((((.(((..(((((((((((((((((.((....(((((((.((((...))))((((((((........(((((......)))))........))))))))...(((((((.(((((((.(((..((((((((((((((.....(((((...((((((((.........))))))))..)))))......(((((((((((.....)))))))))))))))))))).((((((.........))))))((((((........))))))..((.((((.....)))))).((((....)))))))))))).)))))))((((..((((((((...((((.....)))).)).))))))....))))..((((((((((((.(.((((.(((((....).)))).))))....).)))))))))))).((((.((((((((((.((((((((((........((((((((((((((((((.....)))))))..((((.....((((((.(((.((((..........)))).).)).))))))....))))....((((.(((.....(((.....((((((((((...((.(((((((((((((..((((((((((((((((((........))))))))....((((((((.((....)).))))))))))))))).)))..)))..)))..)))).)))))..)))))).....)))).....))).....))).))))((((((((((((((.(((..((((((.(((((((((...(((((((.((((((...(((..((((.((.(.((((((((.((...)))))))))).))).))))..).))...))))))(((((((..........(.(((((((..((..((((..........))))..)).))))))).)..........)))))))...((((........(((....)))((.((.((((((((((..((....))..))))))))))))..))....))))..)))))))...))))..........)))))))))..))..)))...))))))))))).))).((.(((((((((.....)))).))))).))((....)).)))))))))))))))))))))))).))))).))..))))...)))))))...(((.(((.(((.(((((((((((..........))))))).............))))))).)).).)))..))))))))).))).)))))).).)))))))..)))((((...)))).))))))....)).))))).)).)))))))....((((((((.((((((((.........)))))))).......)))))))).(.((((((((..(((...((((.((((((((((......))))))))...((.(((((((....))))....))))))).))))....)))))).))))).)........(.(((((((...))))))).).....).)))))))).....((((.(((((..((....))..))))).))))((((((((...))))))))(((((((..((((..(........)..))))...((.((((((((((....))).)))).))).))...((((.(((((.......))))).))))....(((((((((((((........)))))...(((((((...(((........)))........((((....))))........(((((.........))))).((.(((........))).)).......(((((((.....))).))))....((((((.....(((((((((.............(((((((.(((.((.((((((........)).)))).)).))).....)))))))..........)))))))))....))))))...))))))).........)))))))))))))))..(((...........))).)))).)).))))))))))))))....))))).))))..)).))))...)))).)))))).....)))))))))((((..((.......))..))))...((((((.....))))))..)))))))))))))))))))))..)))....)))))))))..(((((.(((..((((((((((..................(((((((.(((..((((((((...)).))))))..)))...(((.((.....((...........)).....)))))...........(((.(((((........))))))))...((((((((...((.((.((((((((.........)))....))))).))))..))))))))(((((............))))))))))))...((((((((...)))))))).)))))....)))))..))))))))..))))))..))))))).((((((((((((((.......((((..........)))).......)))).)))).))))))..((((........)))).....)))))))))))))))).))).))))......))))).)).))))))))).)).)))))..............(((((((((....(((((((((((((((...)))..))).)))).)))))...)))))))))((((((((((...)))).)))))).((((((((..(((((.((((...)))).)))))..))))))))(((((((((.(((.(((.((((((.......)))))).(((.(((((((.......((.((((...)))).)).......))))))).))).((((((((((.(....((......))....(((((....))))).......................).)))))))))).)))..)))))))))))).))))))))))))))...)).)))))).((((.......(((((((.....(((((((((((((......))).((((.(..(((......))).).))))....(((((((..(((((.((((((((((((((((.(....).)))))))(((((.......))))))))))))))))))).)))))))......))))))))))....)))))))..))))...........)))))))))..((((.........))))((((....))))..))))))))))((((.((((((.........)))))).)))).((((........))))((((..((((....))))))))((...........)).....))))))).)))))))).)).)).)))..)))..))).))))))).)))).)))....))).)))))....))))).)...........)).)))))))))(((((((.(((.......)))......))).))))...(((((((...))).))))......(((((((((((((((((.(((.....(((((((((((((((.((((((..(((...................((((((((...((((.....))))(((((.......(((...)))........)))))....((((((.((....))..))))))....))))))))(((((((..(((....((((......))))(((((...)))))(((((((.((.(((.((..(((((((.(((((((...(((.(((((((((((..((.(((((......(((......((((.....))))...)))...((.(((.((((.((((.((......)).)))).)))).))).))......)))))))...((((....))))..........((((((......))))))...((((...(((((((...((((..((((.....))))..))))..)))))))..))))))))))))))).)))........)))).)))..)))))))((....))...((((....))))...(((((.(((....))).))))))).))).)))).)))))...))).)))))))((.((((.(((.....)))))))))........((.((((((...((((..((((((((...(((.(((((..((((.((((....................))))..))))..((((((...))))))((((.((((.......(((((((......(((((..((....(((.......))).....(((.((((((((((((.......))...))))))))))))).....))..)))))......))))))))))).))))..))))).)))...))))))).)..))))....)))))).)))))........((((....)))).))))))..)))))..)))))).)))).....))).))))))).)))))).))))))))).))))))))))).)))))))))))))))))))).)).).)))))))...)))).....................(((((((((((..(((((.....((((((......)))))).(((.(((.((..(.......)..)).))).)))......)))))..)))))).))))).))..))))))).)))))))))....)))))))))))..........(((((((........(((((((((((....)))))))))))((((.((((((((((((((((((((((.((((..((((........))))(((((..(((....))))))))((((...((((((...((((....)))))).))))....))))(((((((((.(((((.(((.((...(((........)))...(((((((((...((((..(((((((.((.(((((......))))).)).)))).)))....))))....)).)).)))))...................((((((......)))))).)).))))))))...))).))))))(((((.(((((....((.((((..........))))))...)))))..)))))((((.(((((((.(((((...........((((((.((.((((....((.((((...((((((((((((((((.((((.(((..((((........))))((((((((((....)))))))).))....(((((..........))))).................((((.....)))).)))))))))))))))......(.((((((((((.........(((((((((((((((((.(((.(((((((...(((.....)))...(((((....)))))................(((((...))))).........)))))))..(((........)))((((((((..((((....))))(((((.((((((.(((((((((.((((((......)))))).)))..)))))))))))).))))).))))))))((.(((((((.....))))))).))(((.((.(((((.((((((...((((((((((((((((...(((((((((((...(((((.((((.((((.((.((.....)).)).))))..))))))))))))))))(((((((((((((...........(((((((((.....(((((((((.(((...))).))).))))))))))))))).((.....))...)))))))))))))....((((.((((.....(((.((.((.((.....)).)).)))))..(((((...((..(((((((((((((.((.((((.((..(((...((((..(.(((....))).)..)))))))..)).))))..........(((((((..((((......))))..)))))))......(((((((((.((....))....((.....))..((((((....)))))).....))))))).))((((((...(((((.((((.....)))).(((((.....((((((..(((.....)))...((..((((...((.(((..(((.((((((((((....(((...))).......((((((((((((((((.((((.((((((...(((((.(((((((.......(((((.......((((((((...(((((((........)))))))..)))))))).....((((..(((((((..((((((....(((........))))))))).((..............))((((((..(((((((........((((((((...(((((.((...........)).)))))..))))))))(((((((....(((.(((....))))))....)))))))((((........))))(((......)))...................((((((((.....))))))))))))))))))))).(((....((.((.(((((.(..((((((((((.....((((.(((((((((.(((((((((((((........((((....)))).)))))))))))))...)))))))))...........((((....))))....))))...)))....((((((((...............))).)))))))))))).).))))).))))..)))))))))))))).)))))......))))).))))))).))))))...((((.......)))))))).)))).)))))))))))).(((......)))..(((((((((....))))..)))))...........)))))))))).)))..))).))...))))..)))))))).....))))).)))))...))))))..)).)))))))))))))........................))...))))).(((.....(((((.((((((((.((((((...(((((((...(((...(....)...)))....((((((((.(((((((((..............))))..((((((.(((........)))))))))......................(((....)))........)))).).)))))))).(((.((((((.((.((((................)))).)).)))))).))))))))))......)))))))))))))).)))))..)))...)))).))))(((..((...))..)))....))))....)))))....)))))))))))((((((((.....(((((........)))....((((((...((((((...((((((((((....((........)).(((((.....(((((((((((((.((((..(((....))).....(((((((((((((....))..)))))))))))))))))))))))))).))......)))))....))))))))))...........(((((((.....)))......))))((((((((..((((.((.........))))))...)))).......)))).((((....))))((((((((((((((((.......((((....))))...((((((((((...(((.(..((((.(((.(((....(((..((((((.(.((...)).)))))))..........)))........((((((.......)))))).(((((((.(((....))).))).))))..(((((....((((((.(((......))).))))))...))))))))))).))))..).)))...)))).))))))...)))))))..))))))))).))))))...)))))))).....))))))))...............)))))).))))))).)))..)))))))))).(((((((.(((....((...))..))).)))))))..(((.((((..........)))))))....)))))))))).........)))))))))).)...(((((...)))))..........((.((((..(.(((((((((...((((...))))))))))))))..)))))).))))))))...))))))....)))).....)).))))))...........))))).)).......))))).)))).)))))))))))))))))))))))))).))))))))))).....))))).....)))))))(((((((....))))))).......)))))..(((......)))((((((........)))))).((((((..((((.(((..((((.......))))...))).)))).....)))))).)))))))))))))))))))))......(((((((((((((...((((((.......))))))...))))).....)))))))).........((((((((....(((........(((((((((...)))))))))...)))..))))))))..))).)))))).)))..))))))......)))....)))).))))))..)))).....))))))).))))).)))))))).....((..(((((((..((((((((..(((((..............)))))....)))))))).)))))))..))((((((........))))))....((((((((.((................((((((((((...((((((.((((((((.(((..((.(((.(((.(((((...(((((((.(.....).)))))))..(((((............)))))....(((((((((((((...))))))(((((.....)))))(((((.(((.....((((((((...........(((..(((...(((((......))))))))..)))(((((.(((..((.((((....)))).))..))))))))))))))))........))).)))))...(((((((((.((.....))))))...))))).)))))))..((.(((((((((((........)))).))))))))).))))).)))))).))..))).)))...))))).))))))....)))))))))).......))))))))))(((((........))))).......................))))))..((((....))))...))))))))..))))))).)).....))))...)))))........))))).)))))))))..)))..(((((......)))))..(((((((((......(((((((..((((((((((((.(((...........................((((....)))).......(((((((.....)))))))((((....)))).(((((..((((.(..((((((.((((((...((((((((....(((((((.(((((......)))))..)))))))(((((.............))))).(((((((...........))))))).....(((((.......)))))(((((...)))))))))))))........))))))..))))))..).))))..))))).((((....................)))).........))).)))))))))))).)))))))...........(((((((.......)))).)))....((((((((((((((((((((((.(((((.........))))).)).)))))...)))))))))))))))((((.....))))....)))))))))(((...((((((((....)))).))))...)))..........))))).....................
Thermodynamic Ensemble Prediction
...,((((((((((..(((((..((((((.(({{{((((.(((.(.((....))},)))}))))})},})))))))))))..))))))))))..(((((.((((.((((((({...))))))).)))).))))){((,({{{(.{(.{{{{{|,({(.(,{((((((((((((((((((((.....)))))))...,,,(((.(((((((...,(((.({((((((((.....((..((((...))))..)).,..,.....(((...))).))))))))})),)}}))))))).))){(((((.(((...))))))))),,)))))))))))))..,.}}|,}},||||||||}|||||..,..,...,,((((((....)))))).{{,{,,,((((({{((((((((.((({,{(((.{({....,.....,..,,((({.,,.)||}{(((((,(((..(((((((({......,((((((((,(,....,{{,}|||||||}|||||||,,{|({{.,{{(({|||((({,,,.|||||}|,{(((,,,,,..}}}},})))))))))|}{{{{{({(((,.,,{.{{{{|{,||,.,|{{,.||{{{,((((((((({{,..,{({...,||||{((((,{((((((,..|||||||||||||....,.{((((({((((((((((((,,{({{({((({{,...,,||||||{,||,{{({({({((,{{{{{,(({...,((((((...((.(((((((((.......))))))))))).)))))).|,..|})||||{(.,,,.((((.......)))),{||}}}|..||}}|,.(({(,,(((.......{{((,{,,,((((((....))))))....,.|||||}||}}}}.||||||.||{,{(((((...,|}}},.||||||,,,,,,|{(({,(((((.{(((((.{{...}})))))|,|||||,||,,,{{{(((.,,..{{{{(({((((..{{|||{{||||,...})}.)))}))))..))))))),|{||,.,.}}}},||.{((({{{{...{|{|{,..{||.|{{{.{|{{{{{,{{|||{{....{{|.|{||,,,)))}})),,)))|||,|,|.|||||,|}.}}}}}}}..}|,|||,.}}}||||}...,,,,||||(((((((..,((.{{,...|}}|}}.,..)))))))(((........}}}....{(((......))}},|||||,((((((........))))},{{{{{{{{,.........((((.((......)).)))).,{{(((,{{{{{|,,(({{{.,,....))))).,..|}}}|}},.......(((.((((((((,(,.(({({{..........,))}}.,})..}})))))}.}}}..{{(((,,.(((((((...(((........)))))))))).}||||,..}}}}||}}..((((((((..(((({.,...((((((((.(((..((.....}}.))).))))))))....},))))..))))))))|}}}}|,...})),)),,,|||{|,|,...}))|,||,||||}}||{{{,...,.....,...}}}}|(((({..{(((.((.....)).)))})))))))))))},}||||}|}|||,,,{{({(((({,((...,}|||}|,|||,{{{{,{{(,,..,{{||...,,|,||||||,.....((((((,((((((..((((((.......{{((((((((((,.,|{{....,{({((({{,,..((((..........))))(((((..(.(((.{((({{{(....}}))))}..))).).,)))))..{{|||||{|.,.{{{||,|(((.{((,{{{{({{,,{({,,..}}}.,.|||.{((((((,..((((((....))))))....)))))))..}}|......,,,},},}.})))))).)))..}}}}.}}))}..})))))))}||}}|||}},,||,.)|))))))))|,.(((((((..((((((...........))))))..))))))))))).............,((((({.{((.{{...,||.}}}.}}.|||||.......,.||||,,...,|.,,.,))))))..)))))))))))),,||||{{}},.,)))))|)}||,,,..,.,.....}}}))}|)))|{(((((((({{(((((...}}},.||||,}||||...,},))||.}}}}},,,...||}|}},,}}}})))}}}{{{{.......,.))||{{{{{{(({(((({{{((((({{........{((({((((......})}))},)))){{|{||,...)))))).,,|}|},.}}}.,||},}}|||||||||,.||||||{|,,,,,,(({.....}}){{{(({|{{|||||{.{||{{|.||||||{...{{{{.{{(((({{({{....|||}}..,,||||||,|||.|||||{,,,(((({{((({(,.,((({,...,,||||,...,,,..,,,,..(((((...((((((((((....)))))))).))...))))).,((((((.....))).))){{(((,......||||{,.{{|}|}},,||,{{||||{{,.,,}))},|||{|{{|||{|||||||{(((((|{{,.,((((((((((((.,....,{..{{{|||||||,,||||||}}||.,((((((,......,,,|||((((({(,(((({(({((,(((((.,..,(((((,((((({..|{..{{{|{.,,.,|,...{{.((((.(((((.({.,.,{{......}}}....((((((.(((((((...((((((......(((.(({...}))..))).........))))))...))))},)).))))))((((...,..(((..........,})},......))))|,.....,,..}).))))).)))).}}.......,|,|||||,,|}|||}},}|||},,.((({....))))}},,,}|},,...,,,}},}|||))))}})}}))}}||||{{|||,..|||||||{{{...............,|||}}},..}},}}}}...{((((((({{{.{(((,(((((({.(((,,...))}.))),,}}).))),.}})}}})),.......|||{{{|.,||........,,,{{{,.,.}|}(((,.(((((((((.((...((((.((((.{,....,,.)))}..(((({{..........))))))....{{{(((((.,..(((((.....(((.(((((((((......{((((((({({{{({,{{.{((((((((..((({.(((..((((((..((.....))...))))))..)))..))),.)))))).))}...,},|...}||}....(.((((((((...)))))))).)||.|,||}}}}}|.,.(((((.....((((..(((...(({....})).)))..)))))))))..,,{|||.(((((({{((((...,(((((((((..(((.((((((({,({.,...((((.(({{(((.{..((((((((({({..(((.{{{((((((((((((((({.....,.(((.(((.((((((((((((((........))))))))...)))))).})).))).{(((({{(((.,{{.,|||{..,,)))}}},})},)))},.|}}}},..,..,.((.{(.((((((((((((.{(((((((((((((((.((((.(.(((......))).))))).))))))),,{({{,,...{((((((.(((((((((((.,,.((((........)))).,,)))))||,.,,,.,|||((((((((.(((((((((...(((((((.,(((,(((.(({{{.{,{{..((((..(({....}))..}))).,),))))}}.....,}}}))}))),.)))}})))...))).)))))))))}}})))|,,.,,.}}}},,))))).)))))))||},((((((((((((((((.......{{(....((({.{,......,)))))....}}}(((((((.(((((...((.((........)).))...)))))...))))))}..)))))))))))...)))))..|,,.,,{{.||....},)))}..)))))))}.,}.))))))..)))))).)}.}}|},.})))),,}.)})))}},((((((((.((((((.,{(({((,,.,||}}(((((.....))))).,{,{{({{{.{{{{,||{|{,{{,,{.||||{,...,,},,}}||||}||{...,.|,|{||}...,,.((((......}))}..,|,|||,|||..|,))))))}.....}}.,)))).}}}.,))))))...)))))))}}}}||.}},|||,,,,,{|,(({{.|.....,.}))},}}},|.({,(((((((((.(((.((.{.{,.......,.((((((((({.....,((((.....,.,,.,{||{(,(((({..,,({(,,(((((.(((((..(((,({,(((.(((.((.((((..((((....((((,.(((((((((,......,)))...)))))).....)))))))).}))).)).))).))).)))})}}))))).))},}){(...,},..},....}}}...|}}|}},...}|}|||..{((({{{.,|||,....}))}}|))|}.,}}},.|}}},.}}))))))))))))))..........},.})).))).))))),)))},))}))))))))..).)))|(((((..(((.(((((...))))),)),.))))),..,.,,.,,.|{{,..||}|||},........,)))))})|||},...((((..((.....(((((((............,,))))))).......})..))))..}}},})))))))))))..))))....).)))).,.....))))))))))).)))},,))))))))).)))))))).}}.)))))),}})))).,.)).))))..(((((((((((((((,{..,,,....(({({,(......}.)}))))))))))))))))).)))..))))).,))){||||{||{{{,{,{({(((({{{{{{||||||,.,,|||,,|{{((((|,|||||,|||||}|||{{,{{{((,,,({.{{{.,.,}}....,}}}}.}}}}|{|||},..,,)))}},|||||||||||||..||,}}}})}|||||||||,{{{{{{((((({{((({{{...,{({({{{{{{...{{{{.{|||..{{.{{{|,{({.,{{{.|||.|||||,|||||.,|{{||{,,||||,....}}}|||||||,|||||..}|}}||,}}}|||||||,{{{{.{|,,.,,}},||}}{{{{({,,,,,(((((({,.{{(..(((((....(((((.{....}.)))))........(((((...(((((...((....))...))))).)))))..,)))))..}))}}))))..(((((((((.((((((.(({,({..,{|.,,....,,.((((((........))))))........,,.......}}})}.)))))).)))))))))).......(((((,......)))))}}}}}||||,,|||||||..,,}},|)))}}}},||}.{|||||||}}||||,{{((({.((.((((((((.{,((((....(((((..(((((({{(((((({{{(,{((((((,(((({((((((((((((.......(((.,,.((((...))))}.})))))))))))))......,||||}}|{{{{.{..,{{{..,|||||,.,|((((((..((.,{...,|,...((((((...((((.......))))))))))...,}...}}.))...))))))).,,))))))}}})}}....}}))))))).))))))))).}))),}}}||)))}..))))))))}|{,{{{{,|{{,.,,{,(({,.{{{{{.{{{,,.}}},}}}}},.}}}..{{{{,.,,....}))}..|||{{{{..{{{,,....,||{|.{(({...,..}})},|||..,}},,,,},,}||||{{{{{,,,{{{.{,,,({,{{{..,,{,{,|(({{{{{{{,.((((({({........}))),..||||,,.,{{,,(((({{.,,,....,))),}}}}|||}}},.||||||},||,.,}}))}})))))),}),}))..|||{{||{|||{||{||..,,.}|},}}}..,,.,}}}})|||||||,|},},)))}}),},..}|.||}},,,|{{,..,,,|,,{{,.||{||,,.,,||{{{(|((({((((......)))),}}))))))}}.})})))|{||||||((.((((,,,,,.||}|,|||}||}|||{{{{.....|)))}),)))))|))..))))))))}||{{,|||||,|.,,|}}}}}}}},}|{|,,|,{((((((.....})))))}))).,.},|},.|||,....,}})))}||||}}}}})))}}||||||||,|||||{({{((({.{,(((.(((((((....))))))).))}..((((((..............))))))..{(((((((((((((........(((({......)))))........)))))))).)))))},,}.},})))}))),..,|,,,{|||||||||}}.,||{|{,..|{||||||,.},,,.,.)))))))),.|||||..,....,||,|||||{...},)))))))}}))))))))),}{((((((.........))))))|(((({......,.})))},..{{.((((.....)))))}..,||}},|||||||},,}|||||}|||},,,}}.))))}|}}}|||{{(||{{.}||},||})||)))}}}},||,..{(((((((((((.(.((((.(((((....)}}))).)))}....).)))))))))))}}||,|||||||||,,||||,{(((((({{{{{{{{({(((,{{(({(((((((|...|))))))}..||{||{{{,((((((,((..{{{{,,,...}}..)))}.,.)).)))))).}}}}}))},{{((((((((((({.,((({..{((((((((((...((,(((((((((((((..(((((((({(((((((((........))))))))}...((((((((.((....)).)))))))),)))))).)))..)))..))),,))))}})))}..)))))).....(((..((((((......,,,.,...((((((((((((((.(((..((((((.(((((({,,..,(((((((.{{{{{{...{|,..{|||,||.{.((((((((.((...)))))))))).|}|.}}}}..,,)},,,)))|||(((((((({{,,{{.,,(,((((({{..,{..{{((.,,,,,,,..}}}}..}|,|}}}}}},|,.,..(({{{,,,.....))))),..,....,||,..,.|}}}},||.|||||{{|||,.{,..,,))..))})))}}))}}..}}.,..))),..})))))),,.})))},.,,,}.}})))))))))..}),.)))...))))))))))).))),{{.(((((((((.....)))},))))).|||,{((((({{{....}}...))))))),,,,({(((.......,,.((((((({{......||,.....,||.,((((((((((..........))))))).)))..{((((((((((.{{,{(.((((((.((..{{{{..,,(((((...{((((({.||({(,(((({{{{{{{{.{{{(({{{,,{{{....}}).,})))}},..}}|,|}}}||}||||,|||..{{{{{{{||,|||,..{((((({{(({.{((.((((((((...{{{{,{{,,{{(((((({.(((({,(((....)))))))).{{{,|||}}}.}}})....}})}}}....,{{,,......)))),}}..........{.(((((((...))))))).}......)))))))).)))}}}}|({((({,{.{{,.....}})})},}))))((((((((...)))))))))))))}...{{,,..{,,......,..})))..,(({((((((((((....))).))))},)).}}.},{(((.(((((.......))))).)))}...,|||}|}.((((((........)))))}.,||,|{|{{,.(((........))).....,||||||,...}},..,,,....(((((.........))))).,{.{{{........}}},)),....,,(((((((.....)))},)))....))),)})}}}}}}{((({,{,{,,,,..,},.,}}}},..,|||},.,{,(((((((((({.,...((((({..,((..,(((((({..,{{..,.,{{..,,,.}|..|{||,....,,,|...}},,.....{{{(((((.(((....((.(((...,.......))).))...))}.)))))))),}}},....,}}}}.,,}},.},.}}}})))))))}|}|((((((((((({{{{.{((,({{({.....{{|,..,)))...|||||}}.})),)))).}}),...,)))))))))}..}})))))).....))))))))))}..}}.(((({...}))))...............))))))).,))))),|..||||(((({.....))))),)))))))).}}.,,......,,.)))}}))))))}..))))))).,,.......})))}{((....}}|,{.(((((({..((((..(((((((...)))))))...)))))}))))),)),.))))))..))).{(({...,))}}}))))))))......))))))))},}..}||{(((((...))))))||||||{{{|||,.,,{,,{,}}}|||||,||||||||||||{{{{((((((({,{{{|,,,,,..({{{..,....,..}))),,..,,,||}|,}}}||||||||..{(((........))}}..{(,{{{||||||.||{{{{.(((((,,,..|||||.,{({({,,,,((((((.,,,,||||||.,,.,||||...{((((((((....(((((((((((((((...})),.})).)))).)))))...))))))))|((((((((((...))))},)))))}{(((((((..{{{((,({({,..,}}}.|)))},,)))))))|{,(((((((((({,(((,((((((.......)))))),(,{{(((((((({{...{(({,,(({{.||||{,,....)),.})),,,}))).((((((((({,{,...,|......}}....{((((....))))}.....,.................,.))))))))))(((((({.{(|,,{{{.....))))))))))))))))).,..)))}|}}|}}}.,}},{(((((..,,,(((((((((({(({{{{..,|..{(((.{..(((......))).},)))},,}}|||||{{..{((((.((((((((((((((((.(....).)))))))(((((.......))))))))))))))))))},}}}}}}},.....)))))))))}....}}}}}}}...}}},}},.,,.,,}},.)))))),}|||...|,|||,}}}}}||||||||,.,..{{{|{{.,||,((((.((((((......,}.}))))).))))|{{{{{......,}|||(,,,..((((....)))),,,,,},.,.,.,....,))}}}}|}|||||.|||},,))}},,)}}))}.,}}}.,}}}.}}))))},))}))))))),})}.}|||.,.....))))}..}}}}}},},})}})))))}|||{{({{..,,||}|}}.,,.},......}))}}))}...{(({{({...}}}.}},,.....((((((((((((((((((.(((.....(((((((((((((((.(((((({.((,...................((((((((..{((,,...,.,}}}{((((.......(((...)))........))))}....((((((.((,...,.}.)))))).,..))))))))((((((({.(((.,..((((......))))(((((...)))))(((((((.((.(((.((,.(((((((.(((((((...(((.(((((((((((.{((((((((....,.(((......((((.....))))...))).,.,{,(((,((((.((((.((......)).)))).)))}.))).)),,},..)))))))}},{(((....}})),.,,,.,...((((((......))))))...{{{{...(((((((...((((..((((.....))))..))))..)))))))..))))))))))))))).)))........)))).)))..)))))))((....)),..((((....))))..,{((((.(((....))).))))))).))).))))},))))...))).)))))))((.((({{(((.....)))))))))........,,.{(((((...((((.,,(((((((...(((.(((((,,(((({{{,(,,,,{{{.,,,,,..{{.{{||||{{{||.{{((((((...))))))...}},||}},.,...|||||,|}.....(((((((.{....|}}}}.}}}......,,.,||,||{{||||||||,....,.||...}))))}}})),}|,....,,.,})}}}.....,))))))}}}}}.},)),.))))).)))...))))))).)..))))....)))))).,||||,.......{||{,,..))}).))))))}.)))))..}))))).)))).....))).))))))).)))))).))))),,,,.}})}))}|,}},|,|}|||||||||}}|||,,.}}{|.||,,}},...))))....}},..}}})},}},...{((((((((((..(((((.....((((((.....,)))))).....{{{{.((({,,{.,,,{||||..,}|)||.}}}}.)))))..))))))}},))}.}),}))))},,.)))))},}},,..,})))))))}))}}}}}},,.|{{||||,.,,,,,,|((((((((({....)))))))))),||||,||||||||||||{,||||||||,|,,|},||||},,}},......(((((..(((....)))))))),{((.,.{(((((.,.({{{..,,)}))}},}))),.,.}|}|(((((,,....{((({{{(,.|...)}),..})))}.,....,||||||{|..,||{{..(((((((.((.(((((......))))).)).)))).)))..,,||}}...}))}}).)))))||,,},......}|||||||||||||..,(((|(((|....}}||||||.{.,||.||||,||||||,|||||,...||.||||.,,,,,....}}}}}}|.,}}|||..|||}||{|||||{{{,.{|,||||||{{,..|||||,,|{{((,,{{...,.}}.))))})))}),}))||{{||||{.{,{{.{{{||{{{{,....,..}|}|{|{{{{{{{{....})))))}}.)}}},.(((({..........})))}.........,,,|||..((((..,,{|,}},|||||||||}}}}}}.....,||||||||||||}},,}}},,||||,,{({((({({{({{{{.,{{(({{...(((.....)))...(((({....|})))......,||||,|,..{{|||,.,))))),...,}}||||||||,..|||,,,,{{{{|||({{((((,.(((((..{{|||{(((((.((((((.(((((((((.((((((......)))))).)))..)))))))))))).)))))}|||,,,,}{|.(((((((.....))))))).||((({,((((((({((((({,..{{{||||{|||||||,...,{{,.{(((((((((......))))))}},)}{((.(((..{{(((((((((..{{{{(({.,...,(((((((((({{(({{{,,,{{{{.{{{((({{{..,..|||||||||,||,,,,))),,,}.|||}},}}}}}}|||,{{{{........)))}))))))))}}.,.}|},.,}))})...,,,.))))}).))))))))).}}..))).}}},,,.,.,,..,||||||||||||.||,|||{.|({{((({..{(((((((,,({{{{|},.|{||||||,,..,||}}|||,,....,|,(((((((..((((......))))..))))))).,.,,...((({{{(,{{....||{{..(({{{{.,|,.((((((....}|||||,,{{{|||,|||{|(((((((.,.(((((.((((.....)))).(((((..,..((((((..(((.....)))...((..((((...({.(((..(((.((((((((((....(((...))).......((((((((((((((((.(((((.((.((({.{{{{({{((((({,((((((({{((((.....((((((((...((((((({......,)))))))..)))))))){{,,{((.{{{{{{|{{{{.,.{{{{,|||||,.,|||,..}}})}||||||},,,,,.....,...,.(((((({,{((((((...{((((((((((((...(((((.((...........)).)))))..))))))))))}|,(({..{(({.(({....}))},),,...)))...((((........)))){{{......)))...................((((((((.....))))))))))))))))))))).|{{....}}}})))))}}.,,,,,))))))).))))))))))|{||||(((.(((((((((((((,,......((((....)))).,))))))))))))...)))}}|||,........,......,,..,.{(((((((...{{{.{(.({.,,...||.}}}}}.(((((({,|||..{((,(((.,((....{((.....))).....))..))).)))))).....)))))))........,}.))))))))..|,,.)))).))))))).)))).)))))))))))).{{{....,|},,..(((((((((....))))..)))))....,,.....)))))))))).)))..))).})...))))..))))))))..,..))))).))))).,.))))))}.,..,,|||,||||||{,,{{,{{(({{{{{,,{{{{{..,||,{{||,...,(({{,{{((,,({((,,(({,{(((((({{{.((((({..,(((,,{,..{{|,,,|||....,,{{((((.(({{{{(({..............}}}}..(((({{{(((........)))))))))..,....,,...,....,,...{{{....}}}...,,,,,||}|||,|||||}},..{((((,,{.|||||{||,,{,.|||||{{{{{{,,{{{{..{{{{{.||{{.,|||||....{{,||||,,||||||,..,,,,}})))}..))}}..}),....})}}).,)}})))}},.||||{..{|||,,.,..}|||||}}}}}((((((((.,,..,,{{(,.......})}.,,.((((((.{.((((((...{(((((((({,|,,{{........}}.{{{{{|,...(((((((((((((.((((,,{{{...,}}}.,...{(((((((((({({...))..))))))))))}))))))))))))))).)).....,}}}}}.,|.}))))))))}...........|(((({{.....,},.....,)))|{{((((((.,((((.((.........}})))).,.))))}.......}))}((((....)))){(((((((((((((((.......{(((....)))}...((((((((((...(((.(..((((.(((.(((....(((..((((((.(.{{...}}.)))))))..........)))........((((((.......)))))).(((((((.(((....))).))).))))..(((((....((((((.(((......))).))))))...))))))))))).))))..).)))...))))}}))))).}.)))))))..))))))))).))))))..,)))))))}.,,..)))))))).....,......,|,.,,,))}))))),,.)}...))))..))))}(((((((.(((....{{...}}..))).)))))))|.((({(,,{.}}}||,|,|}||||,,.,,,,|||||}},,},,,},,,.},,,,,,})}}},..{{{{{...)))))}}}}..}}}}}}}||||,}.}|||||||,|,.,||||...|}}}))}}))}))}||}}}|||{||||||||,.{{{{|{{{{,..||||||,}||,.,,{{(((({{...{{{..,,,.))),.))))))))},,.}}.}})}})))||}||||||}||||}}}|{||||||}}}}}.,...|||||.....,,})))}{{{{{|{....))))))),...,}})}})),,{{{...,,,))}{(((((........)))))}.{((({{.,{{{{.{{{..{,||,,....,}}}|{,.}}},))}},,...}}}}}}..},,}}}}}||}|},}}})))}.....((((({({(((((...((((((.......))))))...)))))...,,)))}}}}}..{{{{..{(((,((((..{,{{{..,,,{{{(((((((({...})))))))}{{{||,..,,}}}|||{{{||.,}|}}}.,}}..,,,,,,......}|}....,}},.,}}},,..,,,,.....,,,,,,,.}}}|}.||},,}}.....,{{..(((((((..((((((((..(((((.........,....)))))....)))))))).)))))))..}}|{{,,,,,.,.},.))))))}}}||||||||,,||}}}}}},,,...}}}},||||,,|||},,((((((.{{{{{{.,,,,....{,{((,,.....,(({,,{(({{,,,|,,..,}.})))}},..,||||..........,,}})))}}}}||||},|((((((...))))))|((((.....))))}{{{{{.{{{,,...{(((({{,...........{{{..,{{....,,,.......}))})))}..}}|{{(((.{{{,{((.{(((....}))).}}..},,))))}}))))))),....,}}))),)}})}}},|||||||||}||,,..,)))}}|||,,}||{{|(|,,|,...,}|}|||......,.)}}}).)))))))))),)),.)))),))))),}}}).,}))})),}},,}}))))))))))})})))),,))))}})}}}.|||||||,||{........(({...})).,,,...................||||||,,(({{....}}}}...|||||},,..))),}},.}},....,)}},,.})))),,,.,,,})))}).)))))))}}..)))}}|||||..,,,,)))}}..|{|||||{{|{....||||,{(,.{(({{{((((((,{({,..,||..,,,,.{{{{,...,.....{(((....)}}}..,,}..|||||((,....))))))){{{{...,}}}}.,,{{,...,||},..,,,{|||||{{,..(((((((....}}}||||,,,{(((({...,}})))...})))))))|||,,...,},...,},})))),.(((((({...........)))))))...,}}}}}})....)))))),,||||}}}}))))))),,,))})}..})))),)))},))))))}}}}})))}}}}}}}}},,,}}}}}}},,,.....,,.,|||||.},,..,{{|,,.}}}))))))))),))))))),,.........(((((((.......)))).)))....((((((((((((((((((((((.(((((.,.......))))).))})))))...))))))))))))))).}|}}},,.,}})},...}}}}))}}|{{...{{{(((((....))))},}}}...))},}}}}}.,},}))))},},,,...............

Transcripts

ID Sequence Length GC content
ACUUGCUCGGAGGAGCCGGGGCCGAGCGGACCGCCGGCUGCAGGCAGCG… 16583 nt 0.4629
Summary

This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the insertion allele of the RYR2 within the RYR2 gene is significantly associated with an increased risk of Sudden Unexplained Death (SUD), with an odds ratio of 2.03, and correlates with higher RYR2 expression at both mRNA and protein levels in myocardial tissue [Wang et al. DOI:10.1016/J.Forsciint.2016.12.005]. Retrospective analysis further prioritized RYR2 as the most frequently identified causal gene in SUD molecular autopsies, and its expression in human left ventricle tissue exhibits a significant negative correlation with post-mortem interval, which is a critical consideration for forensic transcriptome interpretation [Shen et al. DOI:10.1007/s00414-025-03575-2].