Basic Information

Symbol
S100A1
RNA class
mRNA
Alias
S100 Calcium Binding Protein A1 S100-Alpha S100A S100 Calcium-Binding Protein A1 S-100 Protein Subunit Alpha S-100 Protein Alpha Chain Protein S100-A1 S100 Protein, Alpha Polypeptide S100 Alpha S100
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_006271.2
Sequence length
559.0 nt
GC content
0.5814

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-190.10 kcal/mol
Thermodynamic ensemble
Free energy: -201.22 kcal/mol
Frequency: 0.0000
Diversity: 107.17
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........((((..((((((...(((....))).....((((...((((((((((((....)).((((....)))).))))).)))))..))))..((((.(((((((..........)).))))))))).....((((((.(..((((...........(((.(((...((((((((..((((((.(((....))))))))).)))).))))...))).)))..(((.(.(((((..((((...(((((..((((.((...((.(((...((.....((((((((((.....(((((...(((.((((((((((((((((((.(.((..((....((........))..))..)).))))).)).))))))))...)))).)))..))))).)))).))))))...))...))).))...)).)))))))))....)))).))))))..)))....))))..).))))))..................))))))..))))((((.(((((....))).)).)))).............((((...........)))).
Thermodynamic Ensemble Prediction
.,,.....((((..((((((...,,,...,||,..,,|(((({(.(((((((((({(....}}.{(({....}))}.))))).))))).)))))..((((.(((({{{..........),}))))))))).....((((((.(.,((((...........(((.(((...(((((((,..((((((.(((....))))))))).})))}})))...))).)))..(((.{.(((((..((((...,((((,.({{(,((,..({.(((...((,,...((((((((((.....(((((...(((.((((((((((((((((((,{,{{..({,,..,,....,...}},,))..)),})))).)).))))))))...)))).)))..))))).))))))}))))...}),.,))),))...)),))))}})}),,,,)))).))))),..)))....))))..).))))))..................))))))..))))((((.(((({....}}),)).)))).............||||...........}}}}.

Transcripts

ID Sequence Length GC content
AGCCACAUUUGCAACCUUGGCCAUCUGUCCAGAACCUGCUCCCACCUCA… 559 nt 0.5814
Summary

The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of protein kinase C-mediated phosphorylation. Reduced expression of this protein has been implicated in cardiomyopathies. [provided by RefSeq, Jul 2008]

Forensic Context

A study in rats demonstrated that the S100A1 leaks from cardiomyocytes during ischemic injury [Sabatasso et al. DOI:10.1007/S00414-016-1401-9], and it has been mentioned in the context of immunohistochemical detection studies for the postmortem diagnosis of acute myocardial infarction [Sener et al. DOI:10.1007/S12024-014-9575-2].