| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCCACAUUUGCAACCUUGGCCAUCUGUCCAGAACCUGCUCCCACCUCA… | 559 nt | 0.5814 |
The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of protein kinase C-mediated phosphorylation. Reduced expression of this protein has been implicated in cardiomyopathies. [provided by RefSeq, Jul 2008]
A study in rats demonstrated that the S100A1 leaks from cardiomyocytes during ischemic injury [Sabatasso et al. DOI:10.1007/S00414-016-1401-9], and it has been mentioned in the context of immunohistochemical detection studies for the postmortem diagnosis of acute myocardial infarction [Sener et al. DOI:10.1007/S12024-014-9575-2].