| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCCACCCGCCGCACGUACUAAGGAAGGCGCACAGCCCGCCGCGCUCGC… | 671 nt | 0.4754 |
The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in exocytosis and endocytosis. [provided by RefSeq, Jul 2008]
No relevant information is available at the moment.