Basic Information

Symbol
S100A10
RNA class
mRNA
Alias
S100 Calcium Binding Protein A10 CLP11 P11 ANX2LG CAL1L 42C Annexin II Tetramer (AIIt) P11 Subunit Cellular Ligand Of Annexin II Calpactin I Light Chain Calpactin-1 Light Chain Protein S100-A10 S100 Calcium-Binding Protein A10 (Annexin II Ligand, Calpactin I, Light Polypeptide (P11)) S100 Calcium Binding Protein A10 (Annexin II Ligand, Calpactin I, Light Polypeptide (P11)) Annexin II Ligand, Calpactin I, Light Polypeptide S100 Calcium-Binding Protein A10 Calpactin I P10 Protein ANX2L Ca[1] GP11 P10
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_002966.3
Sequence length
671.0 nt
GC content
0.4754

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-167.20 kcal/mol
Thermodynamic ensemble
Free energy: -179.90 kcal/mol
Frequency: 0.0000
Diversity: 169.15
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........((.(.((((.....((((((((....((.....))...))))).))).....)))).).))..(((....((.(((((((...((((.....))))...(((......((......)).....))).....((((((((((...(((((...))))).))))).)))))........)))))))))....))).....(((((((((((((((((.....(((((((((.(((.....)))((.((((((......))))))..))....((((((((.................((((((((.(((.......)))...)))...))))).((((((((.((((..((((((......))....((((...(((((((...))))).))))))..)))).)))))))))))).((((((...((((.....))))...(((..((((...((.(((...))).)))))))))..))))))))))))))....((......)).)))))))))....))))....(((..((((((....................))))))..)))((((((...(((((((............)))))))..))))))(((((...(((......)))...)))))......)))))))))).))).....
Thermodynamic Ensemble Prediction
........((.{.((((.....((((((((...,((.....}}}}}))))).))).....)))).}.))..(((....((.(((((((({{(,,,.(({{..,,..}))).....}}}}}...........}||.....{{(((|((((...(((((...))))).))))}.))))}........,))))))))....))).....,,{,{{((((({(((((.....(((((((({.(((.....))}({.((((((.....,))))))..)}}},,((((((((.................((((({{(.({{.......}}..,.))),,.))))).(((((((((((((..((((((......))..,,({((,,,{,(((({...))))).,,}}))..)))).)))))))))))).((((((...((((.....)))).,.{{{.....({{,{(.(({...))).}})}}|,}},.}))))))))))))}..,......,..)),)))))))))....)))))...|{{..((((((....................))))))..}}|(((({(,..(((((((,,,.........})})))),,)))))}|{||{,..(((......)))...)}}},......,})))))))),)),.....

Transcripts

ID Sequence Length GC content
ACCCACCCGCCGCACGUACUAAGGAAGGCGCACAGCCCGCCGCGCUCGC… 671 nt 0.4754
Summary

The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in exocytosis and endocytosis. [provided by RefSeq, Jul 2008]

Forensic Context

No relevant information is available at the moment.