Basic Information

Symbol
S100A11
RNA class
mRNA
Alias
S100 Calcium Binding Protein A11 S100C Calgizzarin Metastatic Lymph Node Gene 70 Protein Protein S100-A11 Protein S100-C MLN 70 MLN70 S100 Calcium-Binding Protein A11 (Calgizzarin) Epididymis Secretory Protein Li 43 S100 Calcium-Binding Protein A11 HEL-S-43
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_005620.2
Sequence length
563.0 nt
GC content
0.5311

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-153.50 kcal/mol
Thermodynamic ensemble
Free energy: -163.07 kcal/mol
Frequency: 0.0000
Diversity: 90.05
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.(((((((......(((.....)))......)))).)))......((((.((((..(((.(((..(((((..(((((((((......(((...........))).....))).)))))))))))...)))...)))...))))..((((((.......)))))).((((((..........(((((.((...)).)))))......(((..((((..(((((((((((((((.((((......((....))....((((((((......................))))))))...)))).)).))))))).....(((((.........)))))..(((((.........((((.((((........((((((.((...(((((((...)))).))))))))))).....))))...)))).......))))).................))))))..))))......)))....))))))...))))..........))))..(((((.....)))))......(((.((((........)))).))).........
Thermodynamic Ensemble Prediction
({((,(((((({......,{{..,,.|||{|{..,|,,,.)),.}}},.}},..((((.,(((.(((..(((((..(((((((((......(((...........))).....))).)))))))))))...)))...))).,.)))).....((((((...((((({{{(((.((..........(((((.((...)).)))))............,{....,|{{{(((((((((.((((......((....))....((((((((.......,.....,........))))))))...)))).)).)))))))..,,.(((((.{,....},)))))..(((((.........((((.((((.,......((((({,((..,(((((((...)))).)))))))))))...,.))))...)))).......))))).}}..)))))))))).))))))......,.......|,............})}}}..........})))..(((((.....)))))......{,{.{{{{........))},.,,,.....,...

Transcripts

ID Sequence Length GC content
GAGGAGAGGCUCCAGACCCGCACGCCGCGCGCACAGAGCUCUCAGCGCC… 563 nt 0.5311
Summary

The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in motility, invasion, and tubulin polymerization. Chromosomal rearrangements and altered expression of this gene have been implicated in tumor metastasis. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that S100A11 is a highly expressed mRNA and protein-coding gene in sepsis patients, validated by qPCR and RNA sequencing, and its expression is positively correlated with patient survival [Wang et al. DOI:10.1371/journal.pone.0317608]. Further research in humans using a THP-1-derived macrophage sepsis model showed that silencing the S100A11 significantly reduces the expression of inflammatory cytokines IL-1β, TNF-α, and IL-6 [Cao et al. DOI:10.1186/s12865-025-00778-5].