| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGGAGAGGCUCCAGACCCGCACGCCGCGCGCACAGAGCUCUCAGCGCC… | 563 nt | 0.5311 |
The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in motility, invasion, and tubulin polymerization. Chromosomal rearrangements and altered expression of this gene have been implicated in tumor metastasis. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that S100A11 is a highly expressed mRNA and protein-coding gene in sepsis patients, validated by qPCR and RNA sequencing, and its expression is positively correlated with patient survival [Wang et al. DOI:10.1371/journal.pone.0317608]. Further research in humans using a THP-1-derived macrophage sepsis model showed that silencing the S100A11 significantly reduces the expression of inflammatory cytokines IL-1β, TNF-α, and IL-6 [Cao et al. DOI:10.1186/s12865-025-00778-5].