Basic Information

Symbol
S100A12
RNA class
mRNA
Alias
S100 Calcium Binding Protein A12 CAAF1 CGRP CAGC P6 Extracellular Newly Identified RAGE-Binding Protein Migration Inhibitory Factor-Related Protein 6 Calcium-Binding Protein In Amniotic Fluid 1 Neutrophil S100 Protein ENRAGE MRP6 Protein S100-A12 Calgranulin C EN-RAGE MRP-6 S100 Calcium-Binding Protein A12 (Calgranulin C) S100 Calcium-Binding Protein A12 Calgranulin-C Calcitermin
Location (GRCh38)
1:153373711-153375621
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Sudden cardiac death diagnosis Cause of death analysis Mechanical injury analysis
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_005621.2
Sequence length
485.0 nt
GC content
0.4619

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-131.1 kcal/mol
Thermodynamic ensemble
Free energy: -140.26 kcal/mol
Frequency: 0.0000
Diversity: 116.71
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((.(((.....((((((((...((((.(((.....)))))))...((((....))))...)))))))).......((((((((..((.((((...((((((((((....((((((...((((((..((((((...............))))))......))))))))))))....(((((.......((((((.(((...))).))).)))...............((((((.((((....)))).))))))...........((((((....((.....)).....)))))).......................(((((((.((......)))))))))........))))).((.(((((.....))))).))...))))))))...))...)))).))..((((((..........))))))......)))))))).)))...))))))...((((..........)))).......
Thermodynamic Ensemble Prediction
{(((((.(((...,{((((((((...((((.(((.....)))))))...((((....))))...))))))))..,,...((((((((..((.((((...((((((((((.{{,((((((...((((((..((((((.,,,,,.....},,.))}})),,.,,.))))))||}}}},...(((((.,.{{..((((((.(((...})).))),,))............,,,((((((.((((....)))).)))))}.....,}}...((((((..,.{{.....}}.....))))))...,,,,..,.............(((((((.((......),)))))))........}}}}}.,..{{{|{.|,..})))),)},.,)))))))}...))...)))).))..((((((..........))))))......)))))))).)))...))))))...({((..........}))).......

Transcripts

ID Sequence Length GC content
NM_005621.2 NCBI
CUUCCUUGGCUCAGUGCCCUUCACCACUGCUGGCUUUUUGCUGUAGCUC… 485 nt 0.4619
Summary

The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein is proposed to be involved in specific calcium-dependent signal transduction pathways and its regulatory effect on cytoskeletal components may modulate various neutrophil activities. The protein includes an antimicrobial peptide which has antibacterial activity. [provided by RefSeq, Nov 2014]

Forensic Context

A study in humans identified the S100A12 as a significantly upregulated immune-related gene in acute myocardial infarction (AMI) patients compared to coronary heart disease controls, with its expression highest in neutrophils and decreasing from day 1 to one month post-AMI, demonstrating an area under the curve (AUC) of 0.798 for discriminating AMI [Liu et al. DOI:10.1042/BSR20222552]. Another study in humans found the S100A12 to be significantly upregulated in infective endocarditis and sepsis samples, where it plays a crucial role in immune and inflammatory responses and demonstrates excellent diagnostic performance with an AUC greater than 0.781 [Chen et al. DOI:10.3389/fimmu.2023.1298041]. A study in human traumatic brain injury (TBI) patients demonstrated that S100 calcium binding protein A12 (S100A12) mRNA was one of the five most significantly up-regulated mRNAs in TBI tissue compared to adjacent control tissue, a finding confirmed by quantitative real-time polymerase chain reaction [Yang et al. DOI:10.4103/1673-5374.247467].