| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCUCCUGUCUUGUCUCAGCGGCUGCCAACAGAUCAUGAGCCAUCAGCUC… | 1054 nt | 0.5332 |
This gene encodes a member of the S100 protein family which contains an EF-hand motif and binds calcium. The gene is located in a cluster of S100 genes on chromosome 1. Levels of the encoded protein have been found to be lower in cancerous tissue and associated with metastasis suggesting a tumor suppressor function (PMID: 19956863, 19351828). [provided by RefSeq, Dec 2011]
A study in mice demonstrated that S100A14 was used as a protein marker in multiplex immunofluorescence to identify cells within the molecular profiling of radiation-induced skin injury [Yu et al. DOI:10.1186/s40164-025-00596-w].