Basic Information

Symbol
S100A4
RNA class
mRNA
Alias
S100 Calcium Binding Protein A4 PEL98 P9KA 18A2 FSP1 CAPL MTS1 42A S100 Calcium-Binding Protein A4 (Calcium Protein, Calvasculin, Metastasin, Murine Placental Homolog) Placental Calcium-Binding Protein Fibroblast-Specific Protein-1 Calcium Placental Protein Murine Placental Homolog Protein S100-A4 Metastasin 1 Protein Mts1 Calvasculin Leukemia Multidrug Resistance Associated Protein Malignant Transformation Suppression 1 S100 Calcium-Binding Protein A4 Metastasin
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Sudden death from CNS diseases

MANE select

Transcript ID
NM_002961.3
Sequence length
513.0 nt
GC content
0.5146

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-161.90 kcal/mol
Thermodynamic ensemble
Free energy: -173.75 kcal/mol
Frequency: 0.0000
Diversity: 157.34
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......((((((.......((((((.(((((((((((((((((..((((((((((.((((((....)))).)).(((((((((.......((((.((.(((((.(((....))).).))))....)).))))..))))))).))....))))))....))))..))).....)))))).)))).((((((((((....))).)))))))....)))).)).......((((.(((((..(((....)))...))))).))))..)))).....)))).))((((((((((((.((...((((((((..(((((((.....((.((.(..((((...)))).).)).))...)))..))))..))))))))............(((((.(.((((((((((..((((.((((((((.......))).))))).))))...........)).)))))))).).))))).((.(((((......))))).)).......))))))))))))))...
Thermodynamic Ensemble Prediction
......((((((.......((((((.(((((((((((((((((..((((((((((.({((((...,}}}}.}}.,((((((((.......((((,(({((((,.{{{...,))).)}})))....},.))))..))))))),})..,,}))})}},,.})))..))),....)))))).)))),((((((((((....)))}})}})))....}))).)),....,.((((.(((((..(((....)))..}}}))).))))..}))).....)))).)){(((((((((((.((,{,(({{({((,.({(((((,....|{|{{,,..,,,....,|||,{{||.,,...,,...}}||,,}}||}}||,{.,{,...,{,{((({.(,(({{((((((,,({{{.,{{{||||},.,,,.})),)))),,))},..,,.,,.,,,)).}))))))),),)))))}}|}|{{{{|,,,,.)}))).),.......}))))))))))))}...

Transcripts

ID Sequence Length GC content
AUUCUUCCCCUCUCUACAACCCUCUCUCCUCAGCGCUUCUUCUUUCUUG… 513 nt 0.5146
AUUCUUCCCCUCUCUACAACCCUCUCUCCUCAGCGCUUCUUCUUUCUUG… 562 nt 0.5142
Summary

The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in motility, invasion, and tubulin polymerization. Chromosomal rearrangements and altered expression of this gene have been implicated in tumor metastasis. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the S100A4 identifies a naive neutrophil subset (Neu_S100a4) characterized as the starting point of a neutrophil maturation trajectory following myocardial infarction, with this subset expressing high levels of granule genes [Zhuang et al. DOI:10.1161/JAHA.122.027228]. A study in mice demonstrated that the S100A4 transcript was upregulated 4.1-fold in the injured ipsilateral neocortex three days post-closed head injury, indicating its role in calcium ion binding during the inflammatory response to mild traumatic brain injury [Israelsson et al. DOI:10.1089/neu.2008.0676].