| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCUUCCCCUCUCUACAACCCUCUCUCCUCAGCGCUUCUUCUUUCUUG… | 513 nt | 0.5146 | |
| AUUCUUCCCCUCUCUACAACCCUCUCUCCUCAGCGCUUCUUCUUUCUUG… | 562 nt | 0.5142 |
The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in motility, invasion, and tubulin polymerization. Chromosomal rearrangements and altered expression of this gene have been implicated in tumor metastasis. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the S100A4 identifies a naive neutrophil subset (Neu_S100a4) characterized as the starting point of a neutrophil maturation trajectory following myocardial infarction, with this subset expressing high levels of granule genes [Zhuang et al. DOI:10.1161/JAHA.122.027228]. A study in mice demonstrated that the S100A4 transcript was upregulated 4.1-fold in the injured ipsilateral neocortex three days post-closed head injury, indicating its role in calcium ion binding during the inflammatory response to mild traumatic brain injury [Israelsson et al. DOI:10.1089/neu.2008.0676].