Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCCCCUCGACCGCUCGCGUCGCAUUUGGCCGCCUCCCUACCGCUCCAA… | 434 nt | 0.5415 |
Summary
The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in stimulation of Ca2+-dependent insulin release, stimulation of prolactin secretion, and exocytosis. Chromosomal rearrangements and altered expression of this gene have been implicated in melanoma. [provided by RefSeq, Jul 2008]
Forensic Context
A study in rats demonstrated that S100a6 was downregulated at 24 hours post-injury in organotypic hippocampal slice cultures subjected to both mild (10%) and severe (50%) Lagrangian stretch injury, a model of traumatic brain injury, as confirmed by microarray and RT-qPCR analysis [Di Pietro et al. DOI:10.1089/neu.2009.1095]. In human sepsis research, the S100A6 was identified within a protein-protein interaction network with S100A11 but was not experimentally studied in that context [Cao et al. DOI:10.1186/s12865-025-00778-5].