Basic Information

Symbol
S100A6
RNA class
mRNA
Alias
S100 Calcium Binding Protein A6 PRA Calcyclin CABP CACY 2A9 Prolactin Receptor-Associated Protein Growth Factor-Inducible Protein 2A9 Protein S100-A6 MLN 4 S100 Calcium-Binding Protein A6 (Calcyclin) S100 Calcium-Binding Protein A6 S10A6 5B10
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Cause of death analysis

MANE select

Transcript ID
NM_014624.4
Sequence length
434.0 nt
GC content
0.5415

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-150.40 kcal/mol
Thermodynamic ensemble
Free energy: -158.86 kcal/mol
Frequency: 0.0000
Diversity: 128.92
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......(((((....).)))).(((((((((....((((((((((.(((((..((((((((...((((((((..((((((....(((..(((((.......)))))(((((((..(((.((((.....)))).(((.....)))..(((((((......(((((((..((((...(((....)))))))....)))))))...))).)))).(((.......)))..)))..)))))))(((((.((.......)).))))).))).....)))))).)))))))).....))))))))...))))).).((......))(((((....)))))............(((.((((((((.(((((...)))))..)))))..)))...)))))))))))).((((........)))).....)))))))))...
Thermodynamic Ensemble Prediction
.......{((((,...|,}}}}.{{((((((|...,((((((((({,(((((.{((((((((...((((((((..((((((..,{(((.,{|||||{{{,.(((||,{((((({,.(((.{(((....,)}||{(((.....,,)}}|||{{((......(((((((.{(((({..{((....))))))).},.)))))))...})),)}}}.|||,......))}..))),.)))))))|||||.||},....,)).)))}}}))}.....)))))).)))))))).....)))))))),}.))))).).,{......,,(((((....))))).........,,,({{.((((((((.(((({...)))))..)))))..)))...)))})))))))).,,{{,.......|,.......}))))))}}...

Transcripts

ID Sequence Length GC content
AUCCCCUCGACCGCUCGCGUCGCAUUUGGCCGCCUCCCUACCGCUCCAA… 434 nt 0.5415
Summary

The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in stimulation of Ca2+-dependent insulin release, stimulation of prolactin secretion, and exocytosis. Chromosomal rearrangements and altered expression of this gene have been implicated in melanoma. [provided by RefSeq, Jul 2008]

Forensic Context

A study in rats demonstrated that S100a6 was downregulated at 24 hours post-injury in organotypic hippocampal slice cultures subjected to both mild (10%) and severe (50%) Lagrangian stretch injury, a model of traumatic brain injury, as confirmed by microarray and RT-qPCR analysis [Di Pietro et al. DOI:10.1089/neu.2009.1095]. In human sepsis research, the S100A6 was identified within a protein-protein interaction network with S100A11 but was not experimentally studied in that context [Cao et al. DOI:10.1186/s12865-025-00778-5].