Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAACACUCUGUGUGGCUCCUCGGCUUUGACAGAGUGCAAGACGAUGACU… | 573 nt | 0.5567 |
Summary
The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in the inhibition of casein kinase and altered expression of this protein is associated with the disease cystic fibrosis. This antimicrobial protein exhibits antifungal and antibacterial activity. [provided by RefSeq, Nov 2014]
Forensic Context
A study in humans demonstrated that the S100A9 was significantly upregulated in peripheral blood mononuclear cells from sepsis patients compared to healthy controls, with a log2 fold change of 4.48 [Wu et al. DOI:10.7150/ijms.46910]. A study in mice demonstrated that the S100A9 is a pleiotropic cytokine mediating inflammatory responses through receptor complexes including CD74, CD44, CXCR2, and CXCR4 [Tao et al. DOI:10.1007/s10753-025-02346-w].