Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCCGCCCAGGACCCGCAGCAGAGACGACGCCUGCAGCAAGGAGACCAGG… | 1109 nt | 0.5284 |
Summary
The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21; however, this gene is located at 21q22.3. This protein may function in Neurite extension, proliferation of melanoma cells, stimulation of Ca2+ fluxes, inhibition of PKC-mediated phosphorylation, astrocytosis and axonal proliferation, and inhibition of microtubule assembly. Chromosomal rearrangements and altered expression of this gene have been implicated in several neurological, neoplastic, and other types of diseases, including Alzheimer's disease, Down's syndrome, epilepsy, amyotrophic lateral sclerosis, melanoma, and type I diabetes. [provided by RefSeq, Jul 2008] CIViC Summary for S100B Gene
Forensic Context
A systematic review of post-mortem human studies found that cerebrospinal fluid and serum levels of the S100B are significantly higher in traumatic brain injury fatalities compared to various controls, such as isolated torso trauma [Zwirner et al. DOI:10.1007/S00414-022-02785-2]. A study in mice demonstrated that the S100B is a protein marker for the postmortem diagnosis of asphyxia, as mentioned in the introductory and discussion sections of a study investigating molecular markers to differentiate carbon dioxide intoxication from asphyxia due to oxygen deficiency [Yatsushiro et al. DOI:10.1007/S12024-025-00981-1].