Basic Information

Symbol
S100B
RNA class
mRNA
Alias
S100 Calcium Binding Protein B S100beta S-100 Protein Subunit Beta Protein S100-B S100 Calcium Binding Protein, Beta (Neural) S100 Calcium-Binding Protein, Beta (Neural) S-100 Calcium-Binding Protein, Beta Chain S100 Calcium-Binding Protein B S-100 Protein Beta Chain S100-B S100 NEF
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Cause of death analysis

MANE select

Transcript ID
NM_006272.3
Sequence length
1109.0 nt
GC content
0.5284

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-369.90 kcal/mol
Thermodynamic ensemble
Free energy: -389.72 kcal/mol
Frequency: 0.0000
Diversity: 388.22
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((.(((.(((((((((.(......))))).....((((..(((((((((.((......((..(((((((((((((........(((((...)))))))))..)))))))))..))....((((..((((((((((((..(((....))).......(((........)))((((((.....)))))))))))).))))))..))))..(((((((((.((((((.((((...((.((((((.((((..((.(.(((((((((...((....))...))))).....)))).)))..)))).)))))))).)))).)))).))....)))))))))........................))..)))))))))...........(((.(((......)))))).((((((((((((((((.....(((((((.(((((((((..(((((((...((((((.(((((.......))))).)))))).......((((.....))))...(((((((....)))))))(((..........)))......(((((((....((((...((((....((((....))))....))))..)))).....)))))))(((((....(((((...(((...((((.((((((.((.(((((..((..(((..(((((..(((((................)))))..)))))............................(((....(((((...(((((((((((....)))).)))))))((((.........))))........)))))..))).)))..))..))))).)).)))))))))).)))((((.....))))...((((((.....)))))).)))))...))))))))))))..)))))..)))).............((((.....)))).)))))))(((((((.......))))))).........(((((....)))))))))))))).)))))))))))...((((.....)))).)))))..)))..)))).((..(((.((((...)))).)))..)))))((((((((........)))))))).......
Thermodynamic Ensemble Prediction
.{{{(((,(({.(((({((((.(......|}}}}.||..((((.{(({(,,((({(..,.{,.(({.((((((({{.,,({((((.,,(((({,{{|||}||||.,,,,,}||||||,||.....,,||,{{{||{|||{{,,.(((....))).......{((........))|((((((.....))))))}|||}}.}}|||}.,,))},.(((((((((.((((((.((((...{{.((((((.,(((..((.(.{((((((((...((....))...))))).....)))),}))..))),.))))))}}.)))).)))).))....)))))))))...,.,.{||{{{,.,{{{{|,,.,...})))))}||,..{{{,,{.{(({{(((.....,||,,||{((({{((((,(,((({{,,,.,,,||||.|||,,|,||}},||||||.|||(((((.(((((.......))))).)))))}.......({{{.....}))}...(((((((....)))))))|||,.,,,.,}}}))}},,,..,((((,({{{{{,.{|{.||{||}},{...(((((({((({....))))..))))))).))}})))}).},...||,||||,,,.}}|||||||||||,||,{(({{..{{..,{{{{(((((..(((((................)))))..))))}............................|||,..,|||||..,(((((((((({....}))).))))))}||||,}}}}.}}}.}}||,,.....})))}..|||{||,{{,|{{}|||,.,,})),))),)),,))))){((({.{(((({.{((((((....,||||||,...,}}},}}})))))))))}})))),..))))}..,|,....|,.(({(,....})))}}))}))}|{{{({|||.....))})))){,,...,.,(((({....)))))})))))))).}}})))}}}}}...((((,....))}).})))),,))),.)))).|,..{{(,((({...)))).))),,})||}((((((((........))))))))))}})}.

Transcripts

ID Sequence Length GC content
GCCGCCCAGGACCCGCAGCAGAGACGACGCCUGCAGCAAGGAGACCAGG… 1109 nt 0.5284
Summary

The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21; however, this gene is located at 21q22.3. This protein may function in Neurite extension, proliferation of melanoma cells, stimulation of Ca2+ fluxes, inhibition of PKC-mediated phosphorylation, astrocytosis and axonal proliferation, and inhibition of microtubule assembly. Chromosomal rearrangements and altered expression of this gene have been implicated in several neurological, neoplastic, and other types of diseases, including Alzheimer's disease, Down's syndrome, epilepsy, amyotrophic lateral sclerosis, melanoma, and type I diabetes. [provided by RefSeq, Jul 2008] CIViC Summary for S100B Gene

Forensic Context

A systematic review of post-mortem human studies found that cerebrospinal fluid and serum levels of the S100B are significantly higher in traumatic brain injury fatalities compared to various controls, such as isolated torso trauma [Zwirner et al. DOI:10.1007/S00414-022-02785-2]. A study in mice demonstrated that the S100B is a protein marker for the postmortem diagnosis of asphyxia, as mentioned in the introductory and discussion sections of a study investigating molecular markers to differentiate carbon dioxide intoxication from asphyxia due to oxygen deficiency [Yatsushiro et al. DOI:10.1007/S12024-025-00981-1].