| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAACUCCUCUUUGAUUCUUCUAGCUGUUUCACUAUUGGGCAACCAGACA… | 455 nt | 0.3890 |
This gene encodes calbindin D9K, a vitamin D-dependent calcium-binding protein. This cytosolic protein belongs to a family of calcium-binding proteins that includes calmodulin, parvalbumin, troponin C, and S100 protein. In the intestine, the protein is vitamin D-dependent and its expression correlates with calcium transport activity. The protein may increase Ca2+ absorption by buffering Ca2+ in the cytoplasm and increase ATP-dependent Ca2+ transport in duodenal basolateral membrane vesicles. [provided by RefSeq, Jul 2008]
No relevant information is available at the moment.