| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAUUUUCUCGGCCCUGCCAGCCCCCAGGAGGAAGGUGGGUCUGAAUCU… | 471 nt | 0.5223 |
The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21; however, this gene is located at 4p16. This protein, in addition to binding Ca2+, also binds Zn2+ and Mg2+. This protein may play a role in the etiology of prostate cancer. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the S100P is highly expressed in sepsis patients compared to healthy volunteers, as confirmed by meta-analysis of external datasets and in vitro Q-PCR on LPS-stimulated RAW264.7 cells [Shen et al. DOI:10.1038/s41598-025-90858-8].