Basic Information

Symbol
S100P
RNA class
mRNA
Alias
S100 Calcium Binding Protein P Migration-Inducing Gene 9 Protein S100 Calcium-Binding Protein P Protein S100-P Protein S100-E MIG9 S100E
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_005980.3
Sequence length
471.0 nt
GC content
0.5223

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-150.30 kcal/mol
Thermodynamic ensemble
Free energy: -159.11 kcal/mol
Frequency: 0.0000
Diversity: 87.09
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((....(((((.(((..(((....).))..))))))))((..(((((..((.....))..)))))..))..((((((((((((((.((.(.((.((.(((((...))))).)).)).)((.....))...((((.....))))....((((((((((((((((...(((((((....))).))))(((((((((...((.((.((((((.((((((..((((.......((((((.((.(......).)).))))))......))))..)))))).)))))).)).))....)))).))))))))))...)))))))))))..((((((.((((......(((..((.((((((((((((.(.(((..(((((.((....))))))).)))...).))))).))))).....)).))..))))))))))))).......)).))))).....)))))))))))))).
Thermodynamic Ensemble Prediction
.(((({..,,(((((,(((..(((....).))..))))))})||,.(((((..((.....))..)))))..},..((((((((((((((.((,{{({,{{.(((({...})))).,|,|}||||..,.,}}...((((.....})))}...((((((((((({{(((,..(((((((....)))}})))(((((((((...((.((.((((((.((((((..,((({{.{{{.((((((.(({(...,,.,.}).))))))...}}}})))}})))))).)))))).)).))....)))).)))))))}))}..}))))))))))..((((((.((((......(((..((.((((((((((((.{.(((..(((((.((....))))))).)))...).))))),,)))).....)).))..)))))))))))))..,,,..)).))))),....}))))))))})))).

Transcripts

ID Sequence Length GC content
ACAUUUUCUCGGCCCUGCCAGCCCCCAGGAGGAAGGUGGGUCUGAAUCU… 471 nt 0.5223
Summary

The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21; however, this gene is located at 4p16. This protein, in addition to binding Ca2+, also binds Zn2+ and Mg2+. This protein may play a role in the etiology of prostate cancer. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the S100P is highly expressed in sepsis patients compared to healthy volunteers, as confirmed by meta-analysis of external datasets and in vitro Q-PCR on LPS-stimulated RAW264.7 cells [Shen et al. DOI:10.1038/s41598-025-90858-8].