Basic Information

Symbol
SART1
RNA class
mRNA
Alias
Spliceosome Associated Factor 1, Recruiter Of U4/U6.U5 Tri-SnRNP Squamous Cell Carcinoma Antigen Recognized By T-Cells 1 SNRNP110 Snu66 Ara1 HAF Squamous Cell Carcinoma Antigen Recognised By T Cells Small Nuclear Ribonucleoprotein 110kDa (U4/U6.U5) SART1, U4/U6.U5 Tri-SnRNP-Associated Protein 1 U4/U6.U5 Tri-SnRNP-Associated 110 KDa Protein U4/U6.U5 Tri-SnRNP-Associated Protein 1 Hypoxia Associated Factor SNU66 Homolog HSART-1 SART-1 HSnu66 Squamous Cell Carcinoma Antigen Recognized By T Cells 1 SART1(259) Protein SART1(800) Protein Allergen Hom S 1 IgE Autoantigen SART1259 HOMS1
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_005146.5
Sequence length
3557.0 nt
GC content
0.5963

Transcripts

ID Sequence Length GC content
CGUUGUCUGGGCUCGGCGGCAGCCGGGCUCGGAGUGGACGUGCCACUAU… 3557 nt 0.5963
Summary

This gene encodes two proteins, the SART1(800) protein expressed in the nucleus of the majority of proliferating cells, and the SART1(259) protein expressed in the cytosol of epithelial cancers. The SART1(259) protein is translated by the mechanism of -1 frameshifting during posttranscriptional regulation; its full-length sequence is not published yet. The two encoded proteins are thought to be involved in the regulation of proliferation. Both proteins have tumor-rejection antigens. The SART1(259) protein possesses tumor epitopes capable of inducing HLA-A2402-restricted cytotoxic T lymphocytes in cancer patients. This SART1(259) antigen may be useful in specific immunotherapy for cancer patients and may serve as a paradigmatic tool for the diagnosis and treatment of patients with atopy. The SART1(259) protein is found to be essential for the recruitment of the tri-snRNP to the pre-spliceosome in the spliceosome assembly pathway. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the SART1 mRNA expression increased after death in brain tissue and was significantly correlated with the 0-48 hour postmortem interval, though it showed no significant correlation in heart tissue [Peng et al. DOI:10.1007/S00414-019-02199-7]. A study in mice demonstrated that the SART1 mRNA quantity in brain tissue increased after death and was significantly correlated with the postmortem interval (PMI) over 0-48 hours, with a stronger correlation observed during the initial 0.5-4 hour period [Scrivano et al. DOI:10.1007/s00414-019-02125-x].