| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCGCAGCUCUUAGUCGCGGGCCGACUGGUGUUUAUCCGUCACUCGCCGA… | 1049 nt | 0.4385 |
The protein encoded by this gene belongs to the acetyltransferase family, and is a rate-limiting enzyme in the catabolic pathway of polyamine metabolism. It catalyzes the acetylation of spermidine and spermine, and is involved in the regulation of the intracellular concentration of polyamines and their transport out of cells. Defects in this gene are associated with keratosis follicularis spinulosa decalvans (KFSD). Alternatively spliced transcripts have been found for this gene.[provided by RefSeq, Sep 2009]
A study in rats demonstrated that skeletal muscle contusion induces iron overload and ferroptosis, characterized by increased Fe2+ and MDA alongside decreased GSH and GPX4 levels, which were reversed by ferroptosis inhibitors [Yang et al. DOI:10.3390/ijms252011317].