| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACACACUGUGACGGCUGCCUGAAGCUAGUGAGUCGCGGCGCCGCGCA… | 1613 nt | 0.4203 |
This gene encodes a highly conserved protein that plays an essential role in ribosome biogenesis. The encoded protein interacts with elongation factor-like GTPase 1 to disassociate eukaryotic initiation factor 6 from the late cytoplasmic pre-60S ribosomal subunit allowing assembly of the 80S subunit. Mutations within this gene are associated with the autosomal recessive disorder Shwachman-Bodian-Diamond syndrome. This gene has a closely linked pseudogene that is distally located. [provided by RefSeq, Jan 2017]
No relevant information is available at the moment.