| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAUGCCGCGAUGGAGCGCAGCCCGGGCGGGCGCCGGGGCCGGGGCCCGA… | 4986 nt | 0.6448 |
Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in chromatin remodeling. Predicted to be located in cytoplasm. [provided by Alliance of Genome Resources, Apr 2025]
A study in mice and zebrafish demonstrated that the SBK1 transcript increased in abundance within 0.5 hours postmortem, with its profile identified among 1063 genes showing significant increases after death [Pozhitkov et al. DOI:10.1098/rsob.160267]. In human sepsis research, the SBK1 mRNA was identified as downregulated in the peripheral blood of septic patients compared to healthy controls [Qin et al. DOI:10.1097/JCMA.0000000000000209].