| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCCUCGUCUCUCUCUCUGCGCCUGGGUCGGGUGGGUGACGCCGAGAGCC… | 6065 nt | 0.3416 | |
| GCCUCGUCUCUCUCUCUGCGCCUGGGUCGGGUGGGUGACGCCGAGAGCC… | 6143 nt | 0.3422 |
This gene product belongs to the SCAMP family of proteins, which are secretory carrier membrane proteins. They function as carriers to the cell surface in post-golgi recycling pathways. Different family members are highly related products of distinct genes, and are usually expressed together. These findings suggest that these protein family members may function at the same site during vesicular transport rather than in separate pathways. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
A study in humans identified the SCAMP1 as a member of a ubiquitin-mediated proteolysis gene co-expression module that was downregulated in subjects with methamphetamine-associated psychosis and overlapped with a previous convergent functional genomics-based study validating blood biomarkers for delusions [Breen et al. DOI:10.1038/tp.2016.67]. A study in mice demonstrated that exposure to γ-rays resulted in the down-regulation of the SCAMP1 gene in liver tissue, as identified through oligonucleotide microarray analysis and validated by real-time PCR [Roudkenar et al. DOI:10.1269/jrr.07078].