Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCUGCGUGCGCUGCCGUCCCGGAUCCACCGUGCCUCUGCGGCCUGCGUG… | 3405 nt | 0.5604 |
Summary
The protein encoded by this gene is a plasma membrane receptor for high density lipoprotein cholesterol (HDL). The encoded protein mediates cholesterol transfer to and from HDL. In addition, this protein is a receptor for hepatitis C virus glycoprotein E2 and facilitates cell entry by the virus, SARS-CoV2. [provided by RefSeq, Oct 2021]
Forensic Context
A study in mice demonstrated that Cd36 is a marker for capillary endothelial cells involved in trans-endothelial lipid processing within interscapular brown adipose tissue, as identified through single-nucleus mRNA-sequencing [Behrens et al. DOI:10.1016/j.molmet.2025.102252]. A study in mice demonstrated that the SCARB1 was over-expressed in liver tissue following Kupffer cell-specific and endothelial cell-specific exposures to α-particles, as well as after neutron exposure, as part of a broader inflammatory response characterized by acute-phase protein upregulation [Roudkenar et al. DOI:10.1269/jrr.07078]. In a separate study in rats, the SCARB1 was identified as a metabolism gene involved in lipid catabolism and was significantly down-regulated in liver tissue on day 2 following a 20% total body surface area burn injury [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025].