Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCAACUCCUCGCACUUUGCCCCUGCUUGGCAGCGGAUAAAAGGGGGC… | 5245 nt | 0.4650 |
Summary
This gene encodes an enzyme involved in fatty acid biosynthesis, primarily the synthesis of oleic acid. The protein belongs to the fatty acid desaturase family and is an integral membrane protein located in the endoplasmic reticulum. Transcripts of approximately 3.9 and 5.2 kb, differing only by alternative polyadenlyation signals, have been detected. A gene encoding a similar enzyme is located on chromosome 4 and a pseudogene of this gene is located on chromosome 17. [provided by RefSeq, Sep 2015]
Forensic Context
A study in humans demonstrated that the rs397729601 deletion allele in the DSG2 3' UTR significantly increases sudden cardiac death (SCD) risk (OR=1.51) and correlates with higher myocardial DSG2 mRNA expression, as it functionally interrupts miR-933-3p binding [Zou et al. DOI:10.1016/J.Forsciint.2019.06.008]. Another human study found the rs3036297 insertion allele in the HSPA1B 3' UTR is associated with a lower SCD risk (OR=0.58) by creating a miR-134-5p binding site, while the deletion allele correlates with higher HLA-DRB5 expression via a long-range interaction [Yang et al. DOI:10.1016/J.Forsciint.2020.110637]. These genetic polymorphisms are identified as potential markers for SCD diagnosis and counseling. A study in mice demonstrated that the gene Scd1, a marker for fatty acid desaturase, distinguishes OXPHOS-high brown adipocyte subtypes by higher expression, as identified through single-nucleus mRNA-sequencing of interscapular brown adipose tissue from animals exposed to room temperature or acute and chronic cold [Behrens et al. DOI:10.1016/j.molmet.2025.102252].