| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAAACGGCCCGAGAAGCUCGCCCGGAGAACGGGGAGGAAUAUGCUGUGG… | 2434 nt | 0.4248 |
The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Studies in rodents suggest that the full-length protein, secretogranin II, is involved in the packaging or sorting of peptide hormones and neuropeptides into secretory vesicles. The full-length protein is cleaved to produce the active peptide secretoneurin, which exerts chemotaxic effects on specific cell types, and EM66, whose function is unknown. [provided by RefSeq, Jul 2008]
No relevant information is available at the moment.