Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUACUAGCCCACCAGACUCAGAGACGGAACCAGAGACGGGCCAGAGCAU… | 443 nt | 0.5440 |
Summary
This gene encodes a member of the secretoglobin family of small secreted proteins. The encoded protein has been implicated in numerous functions including anti-inflammation, inhibition of phospholipase A2 and the sequestering of hydrophobic ligands. Defects in this gene are associated with a susceptibility to asthma. [provided by RefSeq, May 2010]
Forensic Context
A study in humans identified the SCGB1A1 as a candidate mRNA marker for nasal mucosa [van den Berge et al. DOI:10.1016/j.fsigen.2015.10.011], but it was excluded from the final multiplex due to poor performance on target tissues. In a separate human study, the SCGB1A1 was also evaluated as a candidate for lung tissue identification [Lindenbergh et al. DOI:10.1007/s00414-013-0895-7], where it was found to be specific but less sensitive than the selected markers SFTPB and SFTPD, and was therefore not taken to further selection rounds. A study in female WAG/RijCmcr rats investigating biomarkers for lethal radiation pneumonitis mentioned the SCGB1A1 as a circulating biomarker for pulmonary fibrosis induced by radiation in its introductory discussion [Medhora et al. DOI:10.3390/ijms24065627].