Basic Information

Symbol
SCGB1D2
RNA class
mRNA
Alias
Secretoglobin Family 1D Member 2 LPHB LIPB Prostatein-Like Lipophilin B Lipophilin-B LPNB Lipophilin B (Uteroglobin Family Member), Prostatein-Like LIPHB
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_006551.4
Sequence length
455.0 nt
GC content
0.4703

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-112.60 kcal/mol
Thermodynamic ensemble
Free energy: -122.11 kcal/mol
Frequency: 0.0000
Diversity: 162.67
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........((.((((((..(((.((((.........))))..((.((((((.(((((.....(((.........)))(((((((((...((....)).)))))))))....)))))......(((....))))))))).)).((((((........))))))..((((((...((.......(((((....)))))))..)))))).........((((........(.(((.(((((.((((..(((.(.(((((((((((......))).((((...((((......))))...))))(.(((((.((.(((((((...((......((((........)))).....)).)))))))..))))))).)((((.......))))......)))))))).)..))).....)))).))))).))).)........)))).)))..)))))).))
Thermodynamic Ensemble Prediction
...,..,.((.((((((..(({.,,{{,,...{{{{||,,..((((......))))...}}}|||.....{{{{{{,(((((((((.{,{,....)).)))))))))..,,,||||,.,,..(((....))){{||{(({,.((((((........)))))).}}}}|}||.,{{{{{,,..{((((....))))},{,,,,{{,,..,,.,|||||}|,|,,{..,}}..||{|..}))})},,},,.})})}}}}||||,|||.{{|{,,{,,|},,,,||,,,...||||{{{{{{{({((((({(,.((((....{(((((((,....{{{{{.{.((({,(,..,,,,|..,,....})))}}))))))),}}}}}}),)))}..)},)))).},))),,}}}...}))))))..,}}}}.}},,,..........}))..)))))).}}

Transcripts

ID Sequence Length GC content
AGGCUCCUGGGGUGGAGUCCAAAUCACUCAUUGUUUGUGAAAGCUGAGC… 455 nt 0.4703
Summary

The protein encoded by this gene is a member of the lipophilin subfamily, part of the uteroglobin superfamily, and is an ortholog of prostatein, the major secretory glycoprotein of the rat ventral prostate gland. Lipophilin gene products are widely expressed in normal tissues, especially in endocrine-responsive organs. Assuming that human lipophilins are the functional counterparts of prostatein, they may be transcriptionally regulated by steroid hormones, with the ability to bind androgens, other steroids and possibly bind and concentrate estramustine, a chemotherapeutic agent widely used for prostate cancer. Although the gene has been reported to be on chromosome 10, this sequence appears to be from a cluster of genes on chromosome 11 that includes mammaglobin 2. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the SCGB1D2 as one of the top five downregulated differentially expressed genes in burn patient skin tissue compared to normal skin, indicating its significant reduction is associated with the burn injury process [Yang et al. DOI:10.3389/fgene.2021.781589].