| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGCGGCUUCCUUGAUCCUUGCCACCCGCGACUGAACACCGACAGCAG… | 506 nt | 0.4229 |
Predicted to be involved in androgen receptor signaling pathway. Predicted to be located in extracellular region. Predicted to be active in extracellular space. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans identified the SCGB2A2 as a candidate mRNA marker for skin identification, ascertained from the GNF SymAtlas database, but it revealed expression signals in skin samples expected to be too low for practical forensic applications [Visser et al. DOI:10.1007/s00414-010-0545-2]. Another human study analyzing transcriptomic datasets of burn patient skin found the SCGB2A2 was one of the top five downregulated differentially expressed genes in burn skin compared to normal skin [Yang et al. DOI:10.3389/fgene.2021.781589].