| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUAGUGGCGGGGCUGAAGGUAAACAGGCUGUUGUGUUUCCUCGGUGCU… | 6793 nt | 0.4425 | |
| UCCUGCUAUACCCACAGUGGUGGUCAUCUCUUCUGAUCUUCACAGCCAA… | 6505 nt | 0.4383 |
Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
A study in humans demonstrated that higher mRNA levels of SCN11A in peripheral blood mononuclear cells (PBMCs) from female bipolar disorder patients were significantly associated with specific clinical sub-phenotypes, including the absence of alcohol dependence, psychosis, and suicide attempts [Voinsky et al. DOI:10.1002/Ddr.21598].