Basic Information

Symbol
SCN11A
RNA class
mRNA
Alias
Sodium Voltage-Gated Channel Alpha Subunit 11 Nav1.9 SCN12A SNS-2 NaN Sodium Channel, Voltage-Gated, Type XI, Alpha Polypeptide Sodium Channel, Voltage-Gated, Type XI, Alpha Subunit Voltage-Gated Sodium Channel Subunit Alpha Nav1.9 Sodium Channel Protein Type 11 Subunit Alpha Sodium Channel Protein Type XI Subunit Alpha Peripheral Nerve Sodium Channel 5 Sensory Neuron Sodium Channel 2 PN5 Sodium Channel, Voltage-Gated, Type XII, Alpha Polypeptide Sodium Channel, Voltage Gated, Type XI Alpha Subunit Sodium Channel, Voltage-Gated, Type XII, Alpha FEPS3 HSAN7 SNS2 HNaN
Location (GRCh38)
Forensic tag(s)
Forensic psychiatry evaluation

MANE select

Transcript ID
NM_001349253.2
Sequence length
6793.0 nt
GC content
0.4425

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1986.40 kcal/mol
Thermodynamic ensemble
Free energy: -2113.78 kcal/mol
Frequency: 0.0000
Diversity: 1738.04
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((((((.(((((.((.(((((........)))))))))))).))))))((((((((..((((.((((((((((((((((((((((((.(((((((((.(((.((((((...(((.......)))..)))))).)))))).))))))(((..(((((((............((((((.((..(((.((((.(((((((((((((.((...)).))))))).((....))(((((.(((....))).))))).(((((((....(((((.(((.......))).))))))))))))..((.((...((((((...(((((((((.(..((((.((......)).))))..))))))))))..((((.......)))).......................((((.(((((((((((..(((((...((((..((.(((((....((((..(((((..(((...((((((((...((((((((((.((((....(((((((....))).)))).)))).....(((((...)))))..))))))..)))).)).)))))))))..))))).))))...))))).))....))))...)).)))...))))...)).)))))..))))))))))....)).)).((((..((((..(((.((((((((((((((..........)))))).))))).).)))))..)))).)))))))))).))))..))))).))))))..........)))))))...))).............).))))))))).........(((((.(((((((..((..((....(((((......((((....................))))....))))).....))..))))))))).......)))))......)))))..........)))))))))..))))((((......))))))))))))......(((((.((((((.((..........((((((((((.(((((((((((((.......(((((((((.(((((((((((.((.(((......)))..)).)))...)))))))).((((...((((.......)))).))))(((((((((........((((((................(((((((((.((((((.(((((....(((((((((((....)))))).))))))))).).))))))...))))))))).((((((.(((((....)).)))))).))).((((......)))).(((((((((((((((.......(((.(((((((((((..(((.....)))..).))).)))))....((.((.((.((.((((.........))))..)))))).))...(((((.(((((((......))))...(((((((((.(((((...(((((((......((((((((....)))))))))))))))...)))))..........(((((((.....(((......)))....)))))))....((((((((((((...((..(((.......))).)).))))((((....((((((...((.....((..((.((((((((....(((((((....((((((((.(((((..((((((((..((((((((....(((((.(((.((((...(((((((((((((((((......((..((((((((((((..(((((((.(((((.((((((((((((...(((...(((((((((((...((((((((((......((((..........))))))))))..))))........(((((......))))).))))))))))).....(((((.....((((((....)))))))))))....((((((((....))))))))((.(((.(((((((.((.((((....))))(((((...))))).......((........))....((((...))))...........)).))))))).))).))...(((((((..(((((....((((((...))))))...((.((.(((((...))))).)).))........)))))((((((.((((((((.....((....))..))))).))).)))))).........(((.((((((...((((((((.....((((...((((((((((.((.....((((((((((((.(((.(((.(...((..(((.....(((.(((((((((.((((((((......((((((...(((((((((...(((..((((....))))....)))...)))))))))))))))...((((((...(((((((.....((((((((.....)))))))).....)))))))..........)))))).............(((.((((............)))).)))..((((....))))..))))))))...)))........((((......)))).)))))))))..))).))).))).))).))))))))))))..))))))))....)))).))))......))))).............(((((....))))))))..)))))).))).....)))))))((((((..((((((((((..(..(((((..((.((((..((((((((((((((.(((((.....((((..(((((((...(((((........((((((.((((......))))...))).)))((.(.(((.(((((((((((.(((((((..(((..((((.(...(((((((((((((((..............((((...(((.((((((((.(...((((((.((......(.(((((((((..(((...)))..))))))))).)......)))))))).....).)))).))))..)))..)))))))))))..)))..)))))..).))))...)))..)))))))..)))))))).......(((((((....)))))))....))).))))))(((((((((((((((.((((((((((..(((((((.......((((((.((.........)))))))).......))))))).))))))..)))))).))))))))))))).......(((((..((((....))))..)))))..))))).((((((.(....((((((((........))))))))...))))))).((((....)))))))))))..))))..((......))(((..(..((((.(((((.(((.(((.....))).)))...)))))))))...)..)))..(((((.....)))))...((..((((....))))..)).)))))..))).)))))))))))....)))).))......(((.(((...))).))).((((((.(((..((..(((((((....(((((..(((((((.((......)).)))))))..(((((((((.(((((..((((..((((((...(((..(((......)))..)))...(((((((((((...((......))....))))))))))).((((((((((....))))))).)))..))))))..)))))))))..)))))....))))((....)).(((..((((((((........))).)))))..))).......)))))..))))))).))..)))))))))))))).)..))))))...))))..)))...))).......((((((((......(((((((........((((((((((...((((((((..(((.(((((((.......(((((((((..((..((((...........))))..)).)).)))))))((((...))))(((((((((..(((((((((((((((((((...))))).........((((((.(((((..(((.((((.((((...))))))))..)))...))))))))))).....)).))))))).(((((((((..(((((.((((..((((....(((((....((......))..)))))..))))..))))...))))).)))))))))......(((((.((....)).)))))............)))))..)))))))))....))))))).)))...))))))))...))))))))))))))))).))))))))...(((.(..((((....))))..).)))(((.((((...((((((((((((...((((.((...((((.(((((.(((.........))).))))).)))))))))).............))).))))))..))))))).)))................)))...))))))))).))).))))))))))))...))))...))))))))..))((((....))))..........)))))))).....(((((((((((.(((((((((.(((...(((((...............................(((((((..........(((....((........))....)))....((((((((((((.((....(((...)))....)).))))).)))))))...................)))))))..(((((((((......)))).)))))..............(((((((((((((...((((.....)))).))))).))))))))..))))).))).))))))))).......(((((((...(((((........)))))....(((.(((........((((((((.((((((((..((((.((((((....))))))...........(((.....((((......)))).....)))((((.((.(((((...........(((((((((.((((.........)))).)))))))))(((.(((((..........)))))..)))))))).))))))((((((((((((.((((.(((((.(.(((((((.....(((.((((((.(((.((.(((((((((((......(((....)))......))))))))..))).)).))))))))).))).........((((((...((((((((.((((.......))))...((......)).(((((((........))))))).))))))))...))))))...........(((.(((((((.....((((((.(((((((....((((((.......((((((...((((.((((((...((((((((....(((...((......((((((.((..((....))..)))))))))).)))....))))))))......)))))).))))...))))))...........))))))..((((((.((..(((((....................))))).....)).))))))(((.(.((...)).).)))(((((((...)))))))........................((((......))))((((((((((((.....((((.....)))).....)))))))..)))))))))))).....))))))))))).))...))).)))).)))).))))).))))))))))......))))))............))))..))))).))))))))))))))))).....(((((((((((((((...(((((((((..........(((((((((..((((.(((......(((.(((..((....))..))).)))...))))))).)))...)))))).........(((((............)))))..((((..((((.(((((((((..(((((..((((......))))..))))).........))).)))))).))))..))))...........(((((((.....))))))).))))))...(((.(((.((.....)).))).))).......))).)))).)))))))))))...((((((((((((....)).)))).))))))...........))))))).........)))))))))))..)))).)))..))...)))).))).)))))...)))))))))))))))))))))............))))))))...))))))).....)))))).))))..))...))..))))))...))))...)))))))))))))))))..))))))))((((((.(((..((((.((.....)).))))...))).)))))).................((((((((.((...(((....)))....)))))))))))).)))..)))))))))))))))((((((..(((.(((....((((..(((((((.(((......).)))))))))))))..))))))....))))))((((.((((((................)))))).))))......(((((.(((((((((.((((.((((((((((((((..((((....))))..))).))))...)))))))..))...)).)))))))))))))).))))))..(((((((((((......)))))(((((......)).)))....(((....)))..))))))....(((((..(.((.....)))..)))))..................(((((((((.....))))))))))))))))))....)))))))))..........))).)))))......)))))...........))))))))))......)).))))))..))))).......
Thermodynamic Ensemble Prediction
,,,{{(((((((((((((((((,..(((((({...{{{{{|{(((((.(((({(((((((({{((((.(((((((((((((((((((((((,.(((((((((.(((.((((((...{{(.......}}}..)))))).))))))}}})))){{{..(((((((.....,{{,,..((((((,((..((,.((((.(((((((((((((,{,...,).)))))))|((....))(((((.(((....))).))))).(((((({...,(((((.{((,,.....))),))))))))))))..{{.{{...((((((...(((((((((.(..((((.((......)).))))..})))))))))..,,((,,,.,,,||||,...................||,({({.((((({{({{{.,{((({{{,,,,|,,{|,||(({....((({,.(((((..(((...((((((((...((((((((((.((((....(((((((....))),,))).))))...,.(((((...)))))..))))))..)))).)).)))))))))..))))).))))..,))}}}.}}.,,|)))}...}}|,||{,..,}},..}},)))}),,)}}}))))))...,||.}}.((((..((((..(({{(({(((((((((((..........)))))).))))).).)})))..)))).)))))))))).))))..)),,)}))))))..,...,,..||}}}}},,,)))},.......,,,.}.)))))))))...,,....(((((.{((((((..((..((....(((((......,{{{.....|,...,,,,...,|,)}}}....))))).....))..)}))))))}.......))))).{,..,}}}}}.,.,,,.,,.)))))))))..)))).}}.....))))))))..})))).)))))){(((((((((.,.((({....(((({..........{((((((((..{{{{....})}}...))))))))|(((.((.(((((((((((((,((((((((,((({{....((,{{({{,||,..}}}..{((((((,,(({...|}|.,.})))))}{{.....,,...........(((((((((.((((((.(((((....(((((((((((....)))))).))))))))).).))))))...)))))))))...{{...||{(((((((({,((((,,..,.((((......))))......{((((...(((....)))...)))))},.},)))))))))))))).})})}}..)),,..}}}.}))))))|||((((.........))))..}}},||{((..,,....,..))))),....))))))))))))))).))}|......(((((((......((((((((....)))))))))))))))...{(((((..{(((((((....,,..{{{(((((((..((((((((.((((((.....((((((((,((((((((,((({.....|({{{,(((((((,{....,}}||,,,||,,...,},.|||.|||,,{({{{{(((((({|......,|,|||,|{{,(((,,(({{((,{((((((((.(((..(((.,{{.,.........,({({(.{{,,{,,,,}},))},.,}.))).((((.(({....}))..))))..)))..))).)),})))))}(((((((((((...((((((((((......((((..........))))))))))..))))........(((((......))))),))))))))))).....{((((.....((((((....))))))))))).,,{({(((({...,,))}))))|{{,{({,{((((||.||.||||,},.||||(|(((.,||}}}},,,,,,|{{........||....((((...))))...........))}}))))),.}}}.,,...,))))))..))).))}..((((((...)))))).,,}|,{({{{((({{{|{||{{({(({,(((((((..((.((((((.((((((((.....{{....}}..))))).))).)))))).},......((((....(((.((......)).))),.))))..(((((((((({.....,(((({...{(({{...((({((((((((..((((.(((((((((((....(((((({{.{{{{..{({,.,..,,,...,})),.}))).)),.....}))))).))))))}...|((({(((((((({,,{((((({..(((((((.....((((((((.....)))))))).....))))))),{{{..{((((((.{(((((({.....{{{{|{(((({(((({....,{{{{,..,||||(((((.(({{,..,{({{.,,,....}.))))}.}}}))}.}}}}|||||,(((,.{(({.(.(((((..(((((((((....(((((((((((.((((.....)))).))))}})),...........})))....))),,)))))..))))).}..))),|||.((((({((.{{{(((((..,,||}}.......,}.}}}}.{((({,.{{||{,.,{{|||}}..,||||,..,,......,||||,,,,,)}}))}},..}}}}||||,|}||||}}}..})))),.}))).}))})....{|||||,,,,,....})))}},.}))))))).{(((((.....))))))}...))))))}..{{{({(....))))}}}}}}((((((,..{((((((((((((((((.((((.(((....)}}.))))))))))))},{,....},.(((((((.((((({(((({((((,,,,.,,,,..........,)))}))))))......{((...(((.....)))...))},.....,,.(((((((((((((.((((,.,,..,,)}}}}}|,(((((((((((((((,((({((((((..(((((((.......((((((.((.........)))))))).......))))))).))))))..)))})).))))))))))))).......(((((..((((....))))..)))))....((..((((((.(....((((((((........))))))))...)))))))..)),})).)))))))))))))))))))))))..{(({{((((({{((((.(((((.(((.(((.....))).}))...))))))))).........,.(((((.....))))),.{(((((({{(((.((((((((.,.,.,((((((((......))))...}})}))...,}..,.))))))))...)))))),,))))..(((((((((((((((..........(((((((,,,......,),}))))))..((,,(((((.(((((..((((..((((((...(((..(((......)))..)))...(((((((((((...,,......,,...,))))))))))).((((((((((....))))))).}))..))))))..)))))))))..)))))..}},,||((....,),||{..(({{({((........)))}})))}..}}}..{{{{.(((((((..(((((,...,(((((,,.)))}).....(((({{{(({,...{{{.|,.......,,..((((((((......{((((((........((((((((((...((((((((..{{(.(((((((.,,....(((((((((..((..((((...........))))..)).)).))))))){(({...}))}(((((((((..(((((((((((({(((((..{{{,,||{..,,{.{{(((,,..|||||..{{{.((((.((({...)))})))).,}}}..}))))}})))})}))}.}).))))))).(((((((((..(((((.((((..((((....(((((....((......))..)))))..))))..))))...))))).)))))))))......(((((.((....)).)))))..,......,..)))))..))))))))).,,,))))))).)),...))))))))...))))))))))))))))}.))))))))...(((.{..((((....))))..).))).....({{,{{({.(((((((((..,((({...,},|{((.(((((.(((.........))).))))).))}}||}},|((((.(((((....((((((((..((({{{......(({{(({.......,,,,,),)))},,..))).))))))))..)))))..))))|||,....,,.,(({.(((,,,..})),..,.,},,,,..))))))}....)).)))))))}}})}}}}}}}}}.}.)))))..))))}})).,,,...,,,.,,..,.......,..))))))........(((((.....(((((,.{(((..((.....((((((((((((.((....(((...)))....)).))))))))))))),,,,{{{{{.,,,,..,{,,,.......||||||||,}}}}}})})},.,,,...............(((((((((((((...((((.....)))).))))).)))))))).........,,,||,.(((((((.(((,...,)))...))))))).,.,,,......}}..)))))))))...))))).)))))))))((((((((,,,(({{((.,,.}}}}}}.,{{|||...))))),...))))))))..,,,,...)))))}.}}}......,.....,,.((..(((((((((.((((.........)))).)))))))))))..(((.((..((((...))))..)).))),)))))))))))))).)))))))))))))},,.,))))}}....,...(((.(((({{{(((.{{.(((((((((((....,,(((....)))..,}..))))))))..})).,).))))))))).))).....,.||((((((...((((((((.{,(({{{....,)))}}.((......)).(((((((........))))))).))))))))...))))))..,,..,.........}}))).}}}}(((((......})))}.................))))))}}))),.},,}}}}}}|||{{,..{,,{((,,{{.{{{,..,}}})))}}...,)}}},)},,,,)))))))))))..}}..)))))))...{((((((.(....{(((((..(((((({....}))))))...))))))}.))))))}.{{{....................})}....,,,},,.,}||}}|}|{,,.||.|{.{|(((((((...))))))),,,..............,{{{,,.{(((......))))((((((((((((.....((({.....}))).....)))))))..)))))))))}))))})))))}}))))}..))))))).)))))))..,}},.,,)))))))))))).}),.,..}))))).....))))))..))))))))....)))))),,,.,..{{........))..,}))}..,.)))).)))}..}})))}..(((((((((.,((((.(((......(((.(((..((....))..))).)))...))))))).)))...))))))...}}.))}.,..)))).)))))))))))))}}...,..((((.(((((((((..(((((..((((......))))..))))).........))).)))))).))))..))))))))))))))))))}|(({{{{.|.,,},,..}.}}}}}}|{{{,,,.,|{{(((((((.....,......,{||||}}}.{{{{{{((((({..{{{,,,((((((....,,.,},)})))),,.......{{{.,.,,,.,,||,|,,,..((((({.|....,,))))))..,,}}.,.....,,,,.....(({{{((,,(({.{{{{...{(,|,..,}..,.,,,{{||{{,.....}}||{{|,{(({{{,,{((({{,{|||{|{..{{{{{{...{{||{|,{|{{,|||,.|({|(,((.{,,||{,..,.}})),.}}))||)}||}}}..,..,.||,..((((((((({.................((((((((,,{(,,({{...,)))..,.}.)))))))),||||.,},}})))}|,||}}..,,.})},,,}))))))}}})})),,|||||||,))}}.....),)))})))))})))..)))))}}(((((((...)))))))|,{.....,}}},,}}},,,,,..}}}}}},.....(((((.(((((((((.(({(.((((((({(((({(,,((({....})))..))).))))...)))))))..})...)).)))))))))))))),}}}}))},||{{{{{{{(({....,}})}}|{{{{......)),})}....|||....}}}..,,}||},{{,(((((....((....,))}..}}}},.....,............(((((((((.....))))))))))}}}}}},,}}}},,}}))}..,,}...},,,}}}}|||||..........{(((((,...,))))),..........|}}},..,))))})}},.,,....

Transcripts

ID Sequence Length GC content
GUUAGUGGCGGGGCUGAAGGUAAACAGGCUGUUGUGUUUCCUCGGUGCU… 6793 nt 0.4425
UCCUGCUAUACCCACAGUGGUGGUCAUCUCUUCUGAUCUUCACAGCCAA… 6505 nt 0.4383
Summary

Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]

Forensic Context

A study in humans demonstrated that higher mRNA levels of SCN11A in peripheral blood mononuclear cells (PBMCs) from female bipolar disorder patients were significantly associated with specific clinical sub-phenotypes, including the absence of alcohol dependence, psychosis, and suicide attempts [Voinsky et al. DOI:10.1002/Ddr.21598].