| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCAGCACCCCGGGGCUGCGCACUGCAGCUCCCCAGGCCACCCACCACCC… | 7805 nt | 0.5749 |
Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the SCN4A mRNA, a component of the Nav1.4 channel, was decreased in ischemic heart tissue three days after coronary artery ligation and was a predicted target of miR-125a and miR-351 [Williams et al. DOI:10.1152/physiolgenomics.00041.2020].