Basic Information

Symbol
SCN4A
RNA class
mRNA
Alias
Sodium Voltage-Gated Channel Alpha Subunit 4 SkM1 Nav1.4 HYPP Sodium Channel, Voltage-Gated, Type IV, Alpha Subunit Sodium Channel Protein Skeletal Muscle Subunit Alpha Voltage-Gated Sodium Channel Subunit Alpha Nav1.4 Sodium Channel Protein Type IV Subunit Alpha Sodium Channel Protein Type 4 Subunit Alpha HYKPP Skeletal Muscle Voltage-Dependent Sodium Channel Type IV Alpha Subunit Sodium Channel, Voltage Gated, Type IV Alpha Subunit Skeletal Muscle Sodium Channel Alpha Subunit CTC-264K15.6 Na(V)1.4 CMYO22A CMYP22A HOKPP2 CMS16 NAC1A
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_000334.4
Sequence length
7805.0 nt
GC content
0.5749

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3068.00 kcal/mol
Thermodynamic ensemble
Free energy: -3197.70 kcal/mol
Frequency: 0.0000
Diversity: 1980.48
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((.((((((((((((.....))))))))......(..(((((.(((..(((.(((.((.(((((((.(((((((((((.....))))).)).)))).)))))((((....(((((((.(((............))).)))).)))...)))))))).))).))).))).)))))..).(((((((((.(.(((((((((..(((.(((((...((((((.(((((..(((..(((..((((...(((((.((((((..........((.(((((((.(((.(......).))).))))))).))........((((((((((....((((.............(((....))).............))))..)))...)))))))...((((((....((((....((((..((((((....)))))))))).)))).))))))((.....))(((((((((((((.((((.(((.((((.(((((((((.((......(((((...((((((((((....)))))))...))).....)))))...(((((((((((..........(((((.((.((....)))))))))......(((((.((((...))))...)))))....))))))))))).((((((...))))))....((((.....)))))).)))))))))))))..))))))).))..)))))..)))))).....)))))))))))...))))..))).))))))))))))))..)))))..(((((...(((((((....((....))...))))))).....(.((((((....((((((((((((((((........(((((.(((((...((((((((((..(((.......((..(((((((.((....))))))).))..))(((((.((((..((..(((((..............((((((((............))))))))))))).........(((((((.((.((((...((......))....)))))).)))))))(((...)))))..)))))))))..((((((((.(((.(....(((((..(((((..((((((((((.((....(((((........)))))(.(((((((....)).))))).).((((....)))))).))))).))))).((((((....((((.(((.....))).))))))))))...))))).(((((((.....))))))).(((((((((((((((..((((((((.(((((.((...(((((.((.((.....((((((...(((((((((((..(....)..))))))).)))).........)))))))).)))))))..((((((((((((.(((((.((((.....(((.((((((((((.(((((((.((((....))))..........))))))).))))).)))))..)))....)))))))))(((((((....)).))))).........))).))))))))))).))))).))))))))..)))).))))...))))))).)))))..).))))).)))))))))..)))))))).))...)))))...))))))))))))(((((....(((...)))..(((...(((((((((((((........))))))...(((((..((.(((....(.(((.(((.....(((((.((....)))))))..))).))))....))).))..)))))..))))))))))(((((((...((((..(((((..((((...(((..((((((((.....(((((((.(((((((((.............))))))).............)))))))))........))))))))((((((.........)))))).(((((((...((((.......))))....)))))))))).)))))))))..))))....))))))).)))))..((....(((((((...)))))))..))))))))))).)))))).).......(((((((...))))))).)))))...(((((((.....)))))))...)))..))))).)))).))))))))))....((((((.....)))))).(((((((..(((.((..........))))).))))))))))).)))))....(((((.((...(((.((...(((((.(((.(((((((((((....((((.((((((((((.(((.((((((...(((((.......(((((((((((...(((((((...((((.....))))..)))......((.((((((((..............((((((...))))))))))))))..))(((((((.((((..((...((((((...(((...)))...))))))...))..)))))))))))..))))...)))))))))))(((.....)))..)))))))))))...((((((....)))))))))))))).)).)))))))))).))))))))))).)))))....)).)))....))..))))).((((((((..(((....((((((...))))))..(((((((((((((..((((((...(.((((........))))).)))))).))))))).))))))(((.(((((..((((((((.(((((((((((((((((((((((((.((((((((.(((((((......((((((..........((((........)))).....((((((((..((((((.((((.....((((((.....)))))).........................((((((......))))))((((((((((((.(((.......)))))))..)).....(((((((.........)))))))((((.(((.((.(.((.....)).))).))).))))....))))))..(((.((.(((.((......)).)))............)).)))(((..(((((((((((.((.((((......(((((((((.((...((((..((.((((...(((.(((.(.((((....(((((((.........(((....))))))))))((((((.((.(((((((((...(((((((((((((......(((((.(((((.....((.(((((((.......)))))...)).))))))).))))).(((.((((((.(((((((((((((((..((((....(((((((((...(((((............((((...((((...((((((((((((((...)))))))).........)))))))))).))))....((((((.........)))))))))))))))))).))..))))..))))))))).((((((......))))))(((......)))....)))))))))))).)))......(((....)))....)))))))))))))....(((((((((((.((((.......(((((((((((((((((((.....(((.((((((((.((((((.(((((((...((((((...(((.(((.........))).)))...)))))).((((((....)))))).....(((((((((.....(((((......((((....((((((((((..((((((((.(((...........(((((.(((((.((...)).))))).))))).......((((((((.(((((((((((..(((((....)))))(((((((((.(((((..((((((..((.(.((((.......(((((.(((.(.....).))).))))))))).).))))))))..)))))...)))).))).))((((((............))))))..(((((((((..((((((((.((((((.((((((..((((((((.(((((.((.((((((....))))...........)).)).))))).))).)))))..))))..((((((((.((.......................)).)))))))).....((((......))))..)).)))))).......((((..((......))..))))..)))).))))....)))))))))..)))))).)))))((((((((((....((((.(......).))))....))))))))))..............))))))))....((((((.(((.(((.........))).))).)))))).(((((((((((((((..(((.(((((..(((((((((((((((((((.......((((((.(((((((.((((.....(((((.(((..((((....(((....(.((((...)))).)...))).)))))))))))).....))))...))).))))...)).)))).....))))))))....))))(.(((((((((.....))))))))))..))))))).((..(((((.((.((((((.....((.(((((..(((((((((((((((.((((.............))))))))......(((((.((((.((((..........))))......)))).)))))((((((..((((((.((((.....((((.....)))).))))..)))))))))))).......((((...(((((((.(((((((.(((.........))).)))....)))).))))....))).))))........))))))....))))).))))).)))))))))).)))))..))((......))...((((.......)))).................(((((...(((((((.(((.....((.(((......))).))......)))))))))).)))))))))))))..)))))..))))))))))))).))))))))...(((((..((((....((.((....))))....))))..)).))).........))))))))))....))))......))))).....(((..((....)).))).........................))))))))))))))))..)))))).........((((((((((.((((((((((((.((((.....))))..))))))...(((((..........)))))..........))))))...))))).))))).............)))).)))).)))....)))))))))))))((((((((((...((((((((.((.((((.((.(((((.((((((.....))).(((((((((((((((.((......(((.((((((.(((.....(((((((((...((((.(((.(((.......))))))((((((((((((..(((((((......)).))))).....((((...(((..((....))....))))))).(((((((((((.(((((((((((((((.(..((((((((.((((((((((((....)))))))))...((((((....((((.((.((((........)))).)...).).)))..))))))..(((((((((.((...((((((.((.(((((((((((....((((((.(((((((((((((((((((((((.(...(((((....))).)).).)).)).)))))))).....)))))))))))((.(((((....))))).)))))))))))))).(((((.......))))).)))))))))))))(((((((..((...))...)))))))...))..)))))))))))).))))))))..)))))))))))........(((......))))))))...)))))))))))......))))))))))))((((((((((((((...............(((((..(((.(((((((.((.(((((((((.((.(((((..(((((.((((....((....)).......)))).)))))))))).))))))....((((.((....)).)))))))))))(((((....)))))...)))))))))).)))))..........(((((((((.((((((((.((((.........)))).(((((.....(((...((((((.(((((..((((((.....))))))...(((..((((..((.........))..)))))))...)))))))))))..))).....)))))..))))))))...)))).).))))..))))).))))))))).))))(((((((...(((((((.(((((((((((((((.(((((((..(((..(((((((((..((..........((((.....))))..((((((((((((((.((((((((......))))((((((.(((((.....))...)))))))))..((((((((.((........)).))))))))...((((..........))))........)))).)))))))))))))).(((((((.(((((((...)))))..(((((((....((((.......))))........(((((.((...(((((((((((((((((.............)))......................((((((...((....))...))))))((((((((((((..(((((((...((((.(((.....)))...))))...)).)))))...........))))))))).)))..((((((((..((((((((...))).))))).))))))))))))))))))))))...))...))))).))))))).......)).))).)))).)).))))).....)))).)))...)))))))((((((((((....((((......(((.(((((...(((..((.....)).)))...))))))))(((((((...((((.(((((((((((((((.((.(......).)).))))))))))).))))((((((((((((.......)))))).)).))))))))...))).))))))))))))))))))))))))))).....))).))).))).))))))))))).)))))).)))))))))))).))))).))).)))))).))))))...)))..)).))).)).)))).))...))))))))..))))))))))((((....))))...((((.......))))((((.........))))....((((((((....)))).)))).((((((..((((......))))..))))))...)))))).......)))).)))...))))))))..)))))))))..)))))))))))).).))).)))...))))))..))))...))..)))))).))))))).)).)))))))))))..)))........))))))))))..((.....)).....)))))))))))))).((((((((((.......))))))))))...))))))).....))))))))..))))))))))))))))).((((((.(((((((((((((((((((....((((((((.((((((...))))))..)).))).)))......((((((..(((.....))))))))).....)))))..)))))))..).))).))).))))))....))))))))..))))....))))..))))))))..(((.((((...(((((.(((((..(((((((.....)))).)))..)))))))))).))))))).(((((.......)))))....)))..))))))))......
Thermodynamic Ensemble Prediction
(((((,(({(((((((((,...,)))))})),,,{{{(.{(((((.{((..{{({{((.,({(((((((.(((((((((((.....))))).)).)))).))))),||{||.|||||{{|,{{{|.,{,||{{,,,|,|,|}}}.|||.|.|||,||||,|||.}||,|||.|||||,{|,(((((((({{(,({{({{{{,..{((,({{((.,,(({(((.{((((...((,,(((.{,(((...|||{|.||||({......}}..{(.(((((({.(((.(......).))).})))))).))..|||...|||{|{,|||,|,}|||{.,....,......({,,.,,||}.,,,,..,.....,})}|..}}||.}}}}}|||,||||||||...||||||,|||{{..((((({....,)))))||||,{.||{|,||||((,.,..||(((((((((((((.((({{(((.(((,,(((((((((.{{..{{{{(((((...((((((((((....)))))))...))).....))))},}}||{((((((({....,,,,,,((((({{{.,,....})}))))))......(((((.((((...))))...))))),..,))))))))}}}.((((((...)))))),,,||{{||,..,}))))}})))))))))))))..))))))).))..)))))..))))),.,.,{{{{||||||||{{,|,,|,||||,|||||||}}}}}}...}}}}}.,||{,.,}}|||||||},.}|{,,,,|}||,}}}})}}{{{{.(.{(((,,....||||{|||||{{{{,{.|||}}}|{{{{(((((((..(((((,..,||}}}})))))}}.||}}|||{{({.((....)))))))}}),,|||,,|}}||}|}}}}}}}}|((,,.,,{...,,...((((((((...,,....},.)))))))).,)),.........{((((((.(,,((((.,|({.....})}.,..)))))).))))))}..,...})}|},,|,(({{{{...{{((((({.(((.{....(({{{,.{{(((..((((((((((.((..|{{(|,,.}}}}...|||||(.((((({{....}}.))))).).{{{{,,,.}}}|}).))))).))))).((((((....((((.(((.....))).))))))))))...)))},.(((((((.....))))))).(((((((((((((((..((((((((.(((((.((...{{({{.{{.((.....((({{{.,.(((((((((((..(....)..))))))).))))......,|.}}}}}})),))))))}..((((((((((((.{((((.((((.,...(((.((((((((((.(((((((.{(((....))),..,,...,,.))))))).))))).))))).,))}....))))))))}(((((((....))}})))).........))).))))))))))).))))).))))))))..)))),,)))...))))))),))}))..}.))))).)))))),))})))..,}}}|))..,)))})}},))}}.},})}),{|||{....|||.}}))},,||(,,.(((((((((((({....,...}}}}})..,({{((,,{(.(((,,.,{.(((,({(.....((((((((...,}|)}}}}..|||,|}},.,,,|||{||{.}}}}|,,||||||||}}{||||||...||||}.,{{{{,{(({{...,||,.((((((((....{(((((((.(((((((((........,....))))))).............)))))))))}}......))))))))||||||,},,.....)))))).{{|||({,..{{{(|.,,,,.}))),,,|||}}}}}}}),))))}))}),,))})....))))})).}}})}.|{|||,,{{{((((...))))))},,,,}}}}}||||,|||.|||||||,.{{(((((((...))))))).))),,...(((((((.....)))))))..,})},,}}))).}))).)))))}}}}}..,,((((((.....)))))).(((((((..(((,{{..........})))).))))))))))),)})))},..||,}},}.,)))))}|{,.,(({{{,(({{(((({{(((((|,,|||((,((((((((((((((.{(((({,..|({||,|||.,|(((((((((((...(((((((...((((,...,))))..))),.....,,.((((((((..............((((((...))))))))))))))..|,(((((((.((((..((...((((((...(((...)))...))))))...)).,)))})))))))..))))...)))))))))))|,,.....})}},}}}})))))))...((((({....}))))))))))))).}}}})}))}||}}.,}}}})))))),))))}.|,.,..}},|,,,}}|,,||||,{{{{{{{(..(((,,,.(((,,,}}}..||||,{{{{{{{(((((((..((((((...(.((((........))))).)))))).))))))))))))))}}{,.(((({{(,{,((((.(((((((((((((((((((((((((.(((((((({({(((((.,....{((((((.,,{.....|||{........}}}).....,((,((((..((((((.((((.....((((((.....)))))).........................((((((......))))))(((((({{((((.{((.......}})))))..,,.....{{{((((.........}))))))((((.(((.((.,.((.....)).})).))).)))}....))))))..,,.{{|,{{{,{(,,,...))|),}....,},.....,||||||||..,((((((((((.((.((((......(((((((((.{(...((((,(((.((((...(((.(((.(.((((....(((((((.........(({....})))))))))((((({,((.(((((((((...(((((((((((((.....,{,(((,(((({.....{{||||{{|{.......))}}}..,)}.}}}||}}.|||||((({{{{{{{||{{{((((((((((((..((((..,.({(((((((...(((((,...........((((...((((...((((((((((((({...}))))))).........)))))))))).))))....,(((({....,,,,.}}}}}))))))))))))).))..))))..))))))))),{{{{({..,,.,}))}}|||..,,}}})))}},.))))))))))}|.}}}......|||,.,,}))....)))))))))))))....{(((((({{((,((({....,.||||{(((((((((((((((..{..(((.{{((((((,(((((,.,,((({{..{(((..((((((((.......{{..((((.((((((((((.((..(((((({....{{{{,{...(({{((......}))))..,}}},,(((....((((((((((..((((((((.(((({,.....,..(((((.(((((.({...)).))))).))))).......((((((((.(((((((((((..(((((....)))))(((((((((.(((((..((((((..((.{,((((.......(((((.(((.{.....}.))).))))))))).),))))))))..)))))...)))).))).))((((({............))))))..(((((((((..((((((((.((((((,{{((((,.((((((((.(((((.{,.((((((....))))...........)).}).))))).))).)))))..}}}}..((((((((.((..,....................)).)))))))).,.,,((((......})))..,).)))))}....,..((((..((......))..)))).,)))).))))....)))))))))..)))))).)))))((((((((((....,{{{.{........}}))....))))))))))..............))))))))....((((((.(((.(((.........))).))).)))))).,{(((((((((((((..(((.(((((..(((((((((((((((((((.......((((((.(((((((.((((.....(((((.(((..{(((....(((.,..(.((((...)))).)..,))).}))))))))))).....))))...))).))))...)).)))).....)))))))),...))))|.(((((((((.....))))))))),..))))))).((..(((((.(,{((((((..,,,({.(((((..(((((((((((((((.((((.............)))))))),.....(((((.((((.((((.,........))))...,..)))).)))))((((((..((((((.((((.....{(((,...,)))).})))..))))))))))))...,.{.((({.,.(((((((.(((((((.(((.........))).)))....)))).))))....))).)))).,.,....})))))....))))).))))),)))))))))).)))))..)){,......))...((((.......)))).................(((((...(((((({,(((,....((.(((......))).))....,.)))))))))).)))))))))))))..)))))..)))))))))))))}))))))))...(((((,.((((.,..({{((....))))..,.)))),.)).))).........))))))))))....)))))))))).....))...)))))))))))))))).......))).)))))....)))}.{(({{{{{|||,||,,,.}),))).}}}}.}}}},{{(({((({.,((((((((,,,.,,,|}}}}}))))}.)))))}...,||||,..}||.}|}),,,.,|,|.,{{.{|||||,,..|||,,.}},}}}...,.}}}}},.)))},}))}.)))....))))))))))))))|((((((((.,.((((((((,{{.((((.(,.{{{{(.((({((.....))).(((((((((((((((.((......(((.((((((.(((,....{((((((((...((((.{{{.((({......)))))){(((((((((((..(((((((......)).))))).....((((...(((..((....}}.,..))))))).(((((((((((.(((((((((((((((.(..((((((((.{,,(((((((((....)))))))))...((({{,,,{{((((.,..((((........)))).}...}.).)}),}))))))..(((((((((.{,...((((((.((.(((((((((((....((((({.(((((((((((((((((((((((.{..{{((((....))).)),}.)).)).)))))))).....))))))))))),|,(((((....))))).)})))})})))))).(((((.......))))).))))))))))))){((((((..{{..,))...)))))}}...}}.,))))))))),}}.))))))))..)))))))))))...,....,,,......}}})))))...)))))))))))......)))))))))))|((((((((((((((..{,...........(((((..(((.(((((((.((.(((((((((.((,(({(({.,{(({.(({(.,,.||....|,|......||||.}}}||||}}|||}}}))..,.((({.{{....)).)))))))))))(((((....)))))...)))))))))).)))))..........(((((((((.((((((((.((({.........)))).(((((.....(((...((((((.(((((..((((((.....)))))).,.{{,..({{{,,|{....,,,..}}..)))},,,...)))))))))))..))).....)))))..})))))))...)))).}.))))..)))))}})))))))),))))(((((((...{((((((.(((((((((((((((.(((((((..{((..(((((((((..(({.........{(((.....))))..((((((((((((((.((((((((.,...,|||}((((((.(((,(.....}}...)))))))))..|||{((((,(({{,,.||.,}.}}}}})))...(({{..........}}))........)))).)))))))))))))).(((((({.,((((((...))))),.(((((((....((((.......))))........(((((.((...((((((((((((((.....,.,........|||...................,,,((((((...((....))...))))))((((((((((({{,(((({{....||((((((({,,..............}).)))))))}...)}.})))))))))).)))..((((((((.,((((((((...))).))))),))))))))))))))))))))))...))...))))).)))))))..,..,,|,.}}),)})).)),))))).....}))).)))...)))))))(((((((((({{((((({..,,{,(((.((((,,{{(((..,{.....||{||||,.,,,))))),,|||||}.}||||,|||||||||||{{{{.,(,(,,,...|,||,||}}}}))))),)}}}||||||((((((.......)))))).}},|||}|||,...,,)})})))}.}))))))))))))))))))).....))).))).))).))))))))))).)))))).)))))))))))).))))).))).)))))),})))))...}}}.})),,,)})).)))).,...}))))))))..))))))))|((((({..(((|..,{((.....}},))))))))))}.......}}},....{((({(((....}})),)))).((((({..{((({....,}}}}.,)))))}.},}))))),}}},,.}))).})},..))))))}}..)))))))))..)))))))))))).}.))).)))...)))}})),))))...},,.)))))).))))))).)).))))))))))}..}}|........))))))))))..))})}.,})))))),},,,}),)))))),((((((((((.......))))))))))..{{||,,,,.}}}}))))))))..))))))))))))))))).((((((.(((((({((((((((((((,{..((((((((.((((((...))))))..)).))).)))......((((((..(((.....))))))))).,.}.)))))..)))))))..}.)))}})).))))))....))))))))..)))).})))))),},,,|||{|{.(((.((((...(((({{(((((..(((((({.....)))).)))..)))))))))).))))))))))}}|..,,....,}......}))..)))))))).}})).

Transcripts

ID Sequence Length GC content
CCAGCACCCCGGGGCUGCGCACUGCAGCUCCCCAGGCCACCCACCACCC… 7805 nt 0.5749
Summary

Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the SCN4A mRNA, a component of the Nav1.4 channel, was decreased in ischemic heart tissue three days after coronary artery ligation and was a predicted target of miR-125a and miR-351 [Williams et al. DOI:10.1152/physiolgenomics.00041.2020].