| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCGAGAGAGGAAGAAAGAGAGGCAGAAAGGGCGUGUUUCUGGCGCUGCG… | 7816 nt | 0.5188 | |
| GCGAGAGAGGAAGAAAGAGAGGCAGAAAGGGCGUGUUUCUGGCGCUGCG… | 7819 nt | 0.5187 |
This gene encodes a member of the signal peptide, complement subcomponents C1r/C1s, Uegf, bone morphogenetic protein-1 and epidermal growth factor-like domain containing protein family. Overexpression of this gene in human embryonic kidney cells results in secretion of a glycosylated form of the protein that forms oligomers and tethers to the cell surface. This gene is upregulated in lung cancer tumor tissue compared to healthy tissue and is associated with loss of the epithelial marker E-cadherin and with increased expression of vimentin, a mesenchymal marker. In addition, the protein encoded by this gene is a transforming growth factor beta receptor ligand, and when secreted by cancer cells, it can be cleaved in vitro to release the N-terminal epidermal growth factor-like repeat domain and the C-terminal complement subcomponents C1r/C1s domain. Both the full length protein and C-terminal fragment can bind to the transforming growth factor beta type II receptor to promote the epithelial-mesenchymal transition and tumor angiogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
No relevant information is available at the moment.